Regulon of PtxS in Pseudomonas fluorescens Pf-5

Properties
Regulator type:	Transcription factor
TF locus tag:	PFL_2721
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	2-ketogluconate utilization
Effector:	2-keto-D-gluconate
Regulog:	PtxS - Pseudomonadaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By TF family - LacI
By effector - 2-keto-D-gluconate
By pathway - 2-ketogluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6.5 Sequence: TCCTGAAACCGGTTTCAGCG Locus tag: PFL_2721 Name: ptxS Funciton: 2-ketogluconate utilization repressor PtxS, LacI family
	PFL_2721	ptxS	2-ketogluconate utilization repressor PtxS, LacI family
Position: -2 Score: 6.5 Sequence: AAATGAAACCGGTTTCAGAG Locus tag: PFL_2720 Name: kguE Funciton: Epimerase KguE Locus tag: PFL_2719 Name: kguK Funciton: 2-ketogluconate kinase (EC 2.7.1.13) Locus tag: PFL_2718 Name: kguT Funciton: 2-ketogluconate transporter Locus tag: PFL_2717 Name: kguD Funciton: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43)
	PFL_2720	kguE	Epimerase KguE
	PFL_2719	kguK	2-ketogluconate kinase (EC 2.7.1.13)
	PFL_2718	kguT	2-ketogluconate transporter
	PFL_2717	kguD	2-ketogluconate 6-phosphate reductase (EC 1.1.1.43)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD