Regulon of Lmo0031 in Listeria monocytogenes EGD-e

Properties
Regulator type:	Transcription factor
TF locus tag:	lmo0031
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Lmo0031 - Listeriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -129 Score: 7.2 Sequence: TTTTGGTAACGTTATCAAAA Position: -34 Score: 7.3 Sequence: ATTTGGTAACGTTACCAAAA Locus tag: lmo0032 Name: lmo0032 Funciton: Putative sugar kinase, ROK family Locus tag: lmo0033 Name: lmo0033 Funciton: glycosyl hydrolase, family 9 Locus tag: lmo0034 Name: lmo0034 Funciton: Putative sugar PTS system, IIC component Locus tag: lmo0035 Name: lmo0035 Funciton: putative sugar-6-phosphate aminotransferase
	lmo0032	lmo0032	Putative sugar kinase, ROK family
	lmo0033	lmo0033	glycosyl hydrolase, family 9
	lmo0034	lmo0034	Putative sugar PTS system, IIC component
	lmo0035	lmo0035	putative sugar-6-phosphate aminotransferase
Position: -187 Score: 7.3 Sequence: TTTTGGTAACGTTACCAAAT Position: -92 Score: 7.2 Sequence: TTTTGATAACGTTACCAAAA Locus tag: lmo0031 Name: lmo0031 Funciton: Putative sugar utilization transcriptional regulator LacI family Locus tag: lmo0030 Name: lmo0030 Funciton: hydrolase, haloacid dehalogenase-like family
	lmo0031	lmo0031	Putative sugar utilization transcriptional regulator LacI family
	lmo0030	lmo0030	hydrolase, haloacid dehalogenase-like family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD