Regulog Lmo0031 - Listeriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Listeriaceae
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Listeria innocua Clip11262 | 6 | 2 |
| Listeria monocytogenes EGD-e | 6 | 2 |
| Listeria seeligeri serovar 1/2b str. SLCC3954 | ||
| Listeria welshimeri serovar 6b str. SLCC5334 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| lmo0032 |
*
Listeria innocua Clip11262 Site: position = -129 score = 7.11087 sequence = ATTTGGTAACGTTATCAAAA Site: position = -34 score = 7.27003 sequence = ATTTGGTAACGTTACCAAAA Gene: lin0031: Putative sugar kinase, ROK family |
*
Listeria monocytogenes EGD-e Site: position = -129 score = 7.18571 sequence = TTTTGGTAACGTTATCAAAA Site: position = -34 score = 7.27003 sequence = ATTTGGTAACGTTACCAAAA Gene: lmo0032: Putative sugar kinase, ROK family |
|
|
Putative sugar kinase, ROK family |
| lmo0033 |
Gene: lin0032: glycosyl hydrolase, family 9 |
Gene: lmo0033: glycosyl hydrolase, family 9 |
|
|
glycosyl hydrolase, family 9 |
| lmo0034 |
Gene: lin0033: Putative sugar PTS system, IIC component |
Gene: lmo0034: Putative sugar PTS system, IIC component |
|
|
Putative sugar PTS system, IIC component |
| lmo0035 |
Gene: lin0034: putative sugar-6-phosphate aminotransferase |
Gene: lmo0035: putative sugar-6-phosphate aminotransferase |
|
|
putative sugar-6-phosphate aminotransferase |
| CRON 2. | |||||
| lmo0031 |
*
Listeria innocua Clip11262 Site: position = -92 score = 7.11087 sequence = TTTTGATAACGTTACCAAAT Site: position = -187 score = 7.27003 sequence = TTTTGGTAACGTTACCAAAT Gene: lin0030: Putative sugar utilization transcriptional regulator LacI family |
*
Listeria monocytogenes EGD-e Site: position = -92 score = 7.18571 sequence = TTTTGATAACGTTACCAAAA Site: position = -187 score = 7.27003 sequence = TTTTGGTAACGTTACCAAAT Gene: lmo0031: Putative sugar utilization transcriptional regulator LacI family |
|
|
Putative sugar utilization transcriptional regulator LacI family |
| lmo0030 |
Gene: lin0029: hydrolase, haloacid dehalogenase-like family |
Gene: lmo0030: hydrolase, haloacid dehalogenase-like family |
|
|
hydrolase, haloacid dehalogenase-like family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |