Regulon of SgaR in Vibrio parahaemolyticus RIMD 2210633

Properties
Regulator type:	Transcription factor
TF locus tag:	VPA0232
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Regulog:	SgaR - Vibrionales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Ascorbate-6-phosphate
By pathway - Ascorbate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -131 Score: 5.9 Sequence: AAATGATAGCGCTATCACAA Position: -110 Score: 6.3 Sequence: TAATGGTAGCGCTATCAGAT Position: -97 Score: 6.3 Sequence: ATCAGATAGCGCTACCATTT Locus tag: VPA0231 Name: sgaA Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) Locus tag: VPA0230 Name: sgaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: VPA0229 Name: sgaT Funciton: Ascorbate-specific PTS system, EIIC component
	VPA0231	sgaA	Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
	VPA0230	sgaB	Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
	VPA0229	sgaT	Ascorbate-specific PTS system, EIIC component
Position: -172 Score: 6.3 Sequence: AAATGGTAGCGCTATCTGAT Position: -159 Score: 6.3 Sequence: ATCTGATAGCGCTACCATTA Position: -138 Score: 5.9 Sequence: TTGTGATAGCGCTATCATTT Locus tag: VPA0232 Name: sgaR Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
	VPA0232	sgaR	Ascorbate utilization transcriptional regulator SgaR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD