Regulon of ManR in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type:	Transcription factor
TF locus tag:	XCC1507
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannosides utilization; Mannose utilization
Effector:	Mannose
Regulog:	ManR - Xanthomonadales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By TF family - LacI
By effector - Mannose
By pathway - Mannosides utilization
By pathway - Mannose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -231 Score: 5.5 Sequence: GCATTAGAACGATCTAATCG Position: -118 Score: 4.3 Sequence: TCGTTGGATGGATACAAAGC Locus tag: XCC1892 Name: omp(Man) Funciton: Mannosides-regulated TonB-dependent outer membrane receptor
	XCC1892	omp(Man)	Mannosides-regulated TonB-dependent outer membrane receptor
Position: -132 Score: 6.2 Sequence: TAATTGGATCGATCCAATCA Locus tag: XCC1507 Name: manR Funciton: Mannose utilization transcriptional regulator ManR, LacI family Locus tag: XCC1508 Name: manP Funciton: Predicted mannose transporter, GGP family Locus tag: XCC1509 Name: manK2 Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) Locus tag: XCC1510 Name: manI2 Funciton: D-mannose isomerase (EC 5.3.1.7)
	XCC1507	manR	Mannose utilization transcriptional regulator ManR, LacI family
	XCC1508	manP	Predicted mannose transporter, GGP family
	XCC1509	manK2	Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
	XCC1510	manI2	D-mannose isomerase (EC 5.3.1.7)
Position: -92 Score: 5.6 Sequence: GATTTGGATCGGTCCAAAGC Locus tag: XCC4222 Name: omp(Man)-2 Funciton: Mannosides-regulated TonB-dependent outer membrane receptor Locus tag: XCC4221 Name: mnnA Funciton: Alpha-1,2-mannosidase
	XCC4222	omp(Man)-2	Mannosides-regulated TonB-dependent outer membrane receptor
	XCC4221	mnnA	Alpha-1,2-mannosidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD