Regulog ManR - Xanthomonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Mannosides utilization; Mannose utilization |
| Effector: | Mannose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By TF family - LacI
- By effector - Mannose
- By pathway - Mannosides utilization
- By pathway - Mannose utilization
| Genome | Genes | Operons |
|---|---|---|
| Stenotrophomonas maltophilia K279a | 8 | 3 |
| Xanthomonas axonopodis pv. citri str. 306 | 6 | 3 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | 7 | 3 |
| Xylella fastidiosa 9a5c |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| omp(Man) |
*
Stenotrophomonas maltophilia K279a Site: position = -62 score = 5.71091 sequence = AAATTAGATCGATTCAAGTT Site: position = -183 score = 5.06757 sequence = CGCTTAGATCGATCCAAGAC Gene: Smlt2179: Mannosides-regulated TonB-dependent outer membrane receptor |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -229 score = 5.52997 sequence = GCATTAGAACGATCTAATCG Site: position = -117 score = 4.85937 sequence = TCGTTGGATCGATACAAAGC Gene: XAC1910: Mannosides-regulated TonB-dependent outer membrane receptor |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -231 score = 5.52997 sequence = GCATTAGAACGATCTAATCG Site: position = -118 score = 4.2504 sequence = TCGTTGGATGGATACAAAGC Gene: XCC1892: Mannosides-regulated TonB-dependent outer membrane receptor |
|
Mannosides-regulated TonB-dependent outer membrane receptor |
| CRON 2. | |||||
| mnnA |
*
Stenotrophomonas maltophilia K279a Site: position = -144 score = 5.57597 sequence = TACTTGAATCGATCTAAATT Gene: Smlt2180: Alpha-1,2-mannosidase |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -302 score = 5.66293 sequence = AGTTTAGATCGATCCAAGCC Gene: XAC4355: Alpha-1,2-mannosidase |
Gene: XCC4221: Alpha-1,2-mannosidase |
|
Alpha-1,2-mannosidase |
| manR |
Gene: Smlt2181: Mannose utilization transcriptional regulator ManR, LacI family |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -90 score = 6.3178 sequence = TAATTGGATCGATCCAATTT Gene: XAC1555: Mannose utilization transcriptional regulator ManR, LacI family |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -132 score = 6.16696 sequence = TAATTGGATCGATCCAATCA Gene: XCC1507: Mannose utilization transcriptional regulator ManR, LacI family |
|
Mannose utilization transcriptional regulator ManR, LacI family |
| manP |
Gene: Smlt2182: Predicted mannose transporter, GGP family |
Gene: XAC1556: Predicted mannose transporter, GGP family |
Gene: XCC1508: Predicted mannose transporter, GGP family |
Gene: XF1609: Predicted mannose transporter, GGP family |
Predicted mannose transporter, GGP family |
| manK2 |
Gene: Smlt2183: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) |
Gene: XAC1557: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) |
Gene: XCC1509: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) |
Gene: XF1610: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) |
Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) |
| manI2 |
Gene: Smlt2184: D-mannose isomerase (EC 5.3.1.7) |
Gene: XAC1558: D-mannose isomerase (EC 5.3.1.7) |
Gene: XCC1510: D-mannose isomerase (EC 5.3.1.7) |
Gene: XF1611: D-mannose isomerase (EC 5.3.1.7) |
D-mannose isomerase (EC 5.3.1.7) |
| mnnB |
Gene: Smlt2185: Beta-mannosidase (EC 3.2.1.25) |
Gene: XAC3075: Beta-mannosidase (EC 3.2.1.25) |
Gene: XCC2891: Beta-mannosidase (EC 3.2.1.25) |
Gene: XF0846: Beta-mannosidase (EC 3.2.1.25) |
Beta-mannosidase (EC 3.2.1.25) |
| omp(Man)-2 |
*
Stenotrophomonas maltophilia K279a Site: position = -87 score = 3.96265 sequence = GTCTTGAACCGATCCAGGTG Site: position = -123 score = 5.42791 sequence = AGTTTGGATCGATCCACAGG Gene: Smlt2175: Mannosides-regulated TonB-dependent outer membrane receptor |
|
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -92 score = 5.57672 sequence = GATTTGGATCGGTCCAAAGC Gene: XCC4222: Mannosides-regulated TonB-dependent outer membrane receptor |
|
Mannosides-regulated TonB-dependent outer membrane receptor |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |