Regulon of BglR in Burkholderia xenovorans LB400

Properties
Regulator type:	Transcription factor
TF locus tag:	Bxe_B2079
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Burkholderia
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -172 Score: 7.1 Sequence: GTGTGGAAGCGCTTCCACTT Locus tag: Bxe_B2084 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: Bxe_B2083 Name: bglE Funciton: Beta-glucosides specific ABC transporter, substrate-binding protein Locus tag: Bxe_B2082 Name: bglF Funciton: Beta-glucosides specific ABC transporter, permease protein 1 Locus tag: Bxe_B2081 Name: bglG Funciton: Beta-glucosides specific ABC transporter, permease protein 2 Locus tag: Bxe_B2080 Name: bglK Funciton: Beta-glucosides specific ABC transporter, ATP-binding protein Locus tag: Bxe_B2079 Name: bglR Funciton: Beta-glucosides utilization transcriptional regulator BglR, LacI family
	Bxe_B2084	bglB	Beta-glucosidase (EC 3.2.1.21)
	Bxe_B2083	bglE	Beta-glucosides specific ABC transporter, substrate-binding protein
	Bxe_B2082	bglF	Beta-glucosides specific ABC transporter, permease protein 1
	Bxe_B2081	bglG	Beta-glucosides specific ABC transporter, permease protein 2
	Bxe_B2080	bglK	Beta-glucosides specific ABC transporter, ATP-binding protein
	Bxe_B2079	bglR	Beta-glucosides utilization transcriptional regulator BglR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD