Regulog BglR - Burkholderia

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Proteobacteria/beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Statistics of regulated genes
Genome	Genes	Operons
Burkholderia cepacia AMMD
Burkholderia glumae BGR1
Burkholderia mallei ATCC 23344
Burkholderia phymatum STM815	6	1
Burkholderia pseudomallei K96243
Burkholderia sp. 383
Burkholderia vietnamiensis G4
Burkholderia xenovorans LB400	6	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
bglB	Burkholderia cepacia AMMD	Burkholderia glumae BGR1	Burkholderia mallei ATCC 23344	* Burkholderia phymatum STM815 Site: position = -86 score = 7.14561 sequence = ATGTGGAAGCGCTTCCACTC Gene: Bphy_5434: Beta-glucosidase (EC 3.2.1.21)	Burkholderia pseudomallei K96243	Burkholderia sp. 383	Burkholderia vietnamiensis G4	* Burkholderia xenovorans LB400 Site: position = -172 score = 7.14561 sequence = GTGTGGAAGCGCTTCCACTT Gene: Bxe_B2084: Beta-glucosidase (EC 3.2.1.21)	Beta-glucosidase (EC 3.2.1.21)
bglE	Burkholderia cepacia AMMD	Burkholderia glumae BGR1	Burkholderia mallei ATCC 23344	Burkholderia phymatum STM815 Gene: Bphy_5435: Beta-glucosides specific ABC transporter, substrate-binding protein	Burkholderia pseudomallei K96243	Burkholderia sp. 383	Burkholderia vietnamiensis G4	Burkholderia xenovorans LB400 Gene: Bxe_B2083: Beta-glucosides specific ABC transporter, substrate-binding protein	Beta-glucosides specific ABC transporter, substrate-binding protein
bglF	Burkholderia cepacia AMMD	Burkholderia glumae BGR1	Burkholderia mallei ATCC 23344	Burkholderia phymatum STM815 Gene: Bphy_5436: Beta-glucosides specific ABC transporter, permease protein 1	Burkholderia pseudomallei K96243	Burkholderia sp. 383	Burkholderia vietnamiensis G4	Burkholderia xenovorans LB400 Gene: Bxe_B2082: Beta-glucosides specific ABC transporter, permease protein 1	Beta-glucosides specific ABC transporter, permease protein 1
bglG	Burkholderia cepacia AMMD	Burkholderia glumae BGR1	Burkholderia mallei ATCC 23344	Burkholderia phymatum STM815 Gene: Bphy_5437: Beta-glucosides specific ABC transporter, permease protein 2	Burkholderia pseudomallei K96243	Burkholderia sp. 383	Burkholderia vietnamiensis G4	Burkholderia xenovorans LB400 Gene: Bxe_B2081: Beta-glucosides specific ABC transporter, permease protein 2	Beta-glucosides specific ABC transporter, permease protein 2
bglK	Burkholderia cepacia AMMD	Burkholderia glumae BGR1	Burkholderia mallei ATCC 23344	Burkholderia phymatum STM815 Gene: Bphy_5438: Beta-glucosides specific ABC transporter, ATP-binding protein	Burkholderia pseudomallei K96243	Burkholderia sp. 383	Burkholderia vietnamiensis G4	Burkholderia xenovorans LB400 Gene: Bxe_B2080: Beta-glucosides specific ABC transporter, ATP-binding protein	Beta-glucosides specific ABC transporter, ATP-binding protein
bglR	Burkholderia cepacia AMMD	Burkholderia glumae BGR1	Burkholderia mallei ATCC 23344	Burkholderia phymatum STM815 Gene: Bphy_5439: Beta-glucosides utilization transcriptional regulator BglR, LacI family	Burkholderia pseudomallei K96243	Burkholderia sp. 383	Burkholderia vietnamiensis G4	Burkholderia xenovorans LB400 Gene: Bxe_B2079: Beta-glucosides utilization transcriptional regulator BglR, LacI family	Beta-glucosides utilization transcriptional regulator BglR, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog BglR - Burkholderia

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --