Regulog BglR - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By TF family - LacI
- By effector - Beta-glucoside
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia cepacia AMMD | ||
| Burkholderia glumae BGR1 | ||
| Burkholderia mallei ATCC 23344 | ||
| Burkholderia phymatum STM815 | 6 | 1 |
| Burkholderia pseudomallei K96243 | ||
| Burkholderia sp. 383 | ||
| Burkholderia vietnamiensis G4 | ||
| Burkholderia xenovorans LB400 | 6 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| bglB |
|
|
|
*
Burkholderia phymatum STM815 Site: position = -86 score = 7.14561 sequence = ATGTGGAAGCGCTTCCACTC Gene: Bphy_5434: Beta-glucosidase (EC 3.2.1.21) |
|
|
|
*
Burkholderia xenovorans LB400 Site: position = -172 score = 7.14561 sequence = GTGTGGAAGCGCTTCCACTT Gene: Bxe_B2084: Beta-glucosidase (EC 3.2.1.21) |
Beta-glucosidase (EC 3.2.1.21) |
| bglE |
|
|
|
Gene: Bphy_5435: Beta-glucosides specific ABC transporter, substrate-binding protein |
|
|
|
Gene: Bxe_B2083: Beta-glucosides specific ABC transporter, substrate-binding protein |
Beta-glucosides specific ABC transporter, substrate-binding protein |
| bglF |
|
|
|
Gene: Bphy_5436: Beta-glucosides specific ABC transporter, permease protein 1 |
|
|
|
Gene: Bxe_B2082: Beta-glucosides specific ABC transporter, permease protein 1 |
Beta-glucosides specific ABC transporter, permease protein 1 |
| bglG |
|
|
|
Gene: Bphy_5437: Beta-glucosides specific ABC transporter, permease protein 2 |
|
|
|
Gene: Bxe_B2081: Beta-glucosides specific ABC transporter, permease protein 2 |
Beta-glucosides specific ABC transporter, permease protein 2 |
| bglK |
|
|
|
Gene: Bphy_5438: Beta-glucosides specific ABC transporter, ATP-binding protein |
|
|
|
Gene: Bxe_B2080: Beta-glucosides specific ABC transporter, ATP-binding protein |
Beta-glucosides specific ABC transporter, ATP-binding protein |
| bglR |
|
|
|
Gene: Bphy_5439: Beta-glucosides utilization transcriptional regulator BglR, LacI family |
|
|
|
Gene: Bxe_B2079: Beta-glucosides utilization transcriptional regulator BglR, LacI family |
Beta-glucosides utilization transcriptional regulator BglR, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |