Regulon of XCC4129 in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type:	Transcription factor
TF locus tag:	XCC4129
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	XCC4129 - Xanthomonadales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -172 Score: 6.5 Sequence: TCATGTAAGCGCTTGCAGTT Locus tag: XCC4129 Name: XCC4129 Funciton: Transcriptional regulator, LacI family Locus tag: XCC4131 Name: ompA Funciton: OmpA-related protein Locus tag: XCC4132 Name: omp Funciton: Putative carbohydrate outer membrane transporter, TonB-dependent Locus tag: XCC4133 Name: prnA Funciton: tryptophan halogenase
	XCC4129	XCC4129	Transcriptional regulator, LacI family
	XCC4131	ompA	OmpA-related protein
	XCC4132	omp	Putative carbohydrate outer membrane transporter, TonB-dependent
	XCC4133	prnA	tryptophan halogenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD