Regulog XCC4129 - Xanthomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Stenotrophomonas maltophilia K279a
Xanthomonas axonopodis pv. citri str. 306	4	1
Xanthomonas campestris pv. campestris str. ATCC 33913	4	1
Xylella fastidiosa 9a5c

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
XCC4129	Stenotrophomonas maltophilia K279a	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -175 score = 6.52087 sequence = TCATGTAAGCGCTTGCAGTT Gene: XAC4272: Transcriptional regulator, LacI family	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -172 score = 6.52087 sequence = TCATGTAAGCGCTTGCAGTT Gene: XCC4129: Transcriptional regulator, LacI family	Xylella fastidiosa 9a5c	Transcriptional regulator, LacI family
ompA	Stenotrophomonas maltophilia K279a	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC4273: OmpA-related protein	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC4131: OmpA-related protein	Xylella fastidiosa 9a5c	OmpA-related protein
omp	Stenotrophomonas maltophilia K279a	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC4274: Putative carbohydrate outer membrane transporter, TonB-dependent	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC4132: Putative carbohydrate outer membrane transporter, TonB-dependent	Xylella fastidiosa 9a5c	Putative carbohydrate outer membrane transporter, TonB-dependent
trpH	Stenotrophomonas maltophilia K279a	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC4275: tryptophan halogenase	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC4133: tryptophan halogenase	Xylella fastidiosa 9a5c	tryptophan halogenase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --