Regulon of HpxR in Ralstonia eutropha JMP134

Properties
Regulator type:	Transcription factor
TF locus tag:	Reut_B4528
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Xanthine utilization
Effector:	Xanthine
Regulog:	HpxR - Ralstonia
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By TF family - LacI
By effector - Xanthine
By pathway - Xanthine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -119 Score: 6.9 Sequence: TAACCAAAACGTTTTGGCTA Locus tag: Reut_B4531 Name: uraA Funciton: Xanthine/uracil permease Locus tag: Reut_B4530 Name: COG0402 Funciton: Cytosine deaminase and related metal-dependent hydrolases Locus tag: Reut_B4529 Name: PF01925 Funciton: Protein of unknown function DUF81
	Reut_B4531	uraA	Xanthine/uracil permease
	Reut_B4530	COG0402	Cytosine deaminase and related metal-dependent hydrolases
	Reut_B4529	PF01925	Protein of unknown function DUF81

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD