Regulog HpxR - Ralstonia

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Xanthine utilization
Effector:	Xanthine
Phylum:	Proteobacteria/beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
uraA	* Cupriavidus taiwanensis Site: position = -203 score = 6.92778 sequence = TTACCAAAACGTTTTTGTTA Gene: RALTA_B0719: Xanthine/uracil permease	* Ralstonia eutropha H16 Site: position = -119 score = 6.66994 sequence = TTACCAAAACGTTTTTGTTT Gene: H16_B0861: Xanthine/uracil permease	* Ralstonia eutropha JMP134 Site: position = -119 score = 6.90087 sequence = TAACCAAAACGTTTTGGCTA Gene: Reut_B4531: Xanthine/uracil permease	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	Xanthine/uracil permease
COG0402	Cupriavidus taiwanensis Gene: RALTA_B0720: Cytosine deaminase and related metal-dependent hydrolases	Ralstonia eutropha H16 Gene: H16_B0862: Cytosine deaminase and related metal-dependent hydrolases	Ralstonia eutropha JMP134 Gene: Reut_B4530: Cytosine deaminase and related metal-dependent hydrolases	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	Cytosine deaminase and related metal-dependent hydrolases
PF01925	Cupriavidus taiwanensis Gene: RALTA_B0721: Protein of unknown function DUF81	Ralstonia eutropha H16 Gene: H16_B0863: Protein of unknown function DUF81	Ralstonia eutropha JMP134 Gene: Reut_B4529: Protein of unknown function DUF81	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	Protein of unknown function DUF81

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --