Regulon of MalR in Pseudoalteromonas atlantica T6c

Properties
Regulator type:	Transcription factor
TF locus tag:	Patl_2185
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Alteromonadales
Statistics of regulated genes:
- Genes	14
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -166 Score: 5.8 Sequence: GGTTGAATACGTATTCAACC Locus tag: Patl_2197 Name: glgP Funciton: Glycogen phosphorylase (EC 2.4.1.1)
	Patl_2197	glgP	Glycogen phosphorylase (EC 2.4.1.1)
Position: -90 Score: 5.7 Sequence: TAATGCAAACGTATTCAACT Locus tag: Patl_1635 Name: malQ Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) Locus tag: Patl_1636 Name: glgB Funciton: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18) Locus tag: Patl_1637 Name: glgX Funciton: Glycogen debranching enzyme (EC 3.2.1.-)
	Patl_1635	malQ	4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
	Patl_1636	glgB	1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
	Patl_1637	glgX	Glycogen debranching enzyme (EC 3.2.1.-)
Position: -213 Score: 5.9 Sequence: ATCTGAATACGTATGCAAGC Locus tag: Patl_2187 Name: malT Funciton: Predicted maltose transporter MalT Locus tag: Patl_2186 Name: cgt Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
	Patl_2187	malT	Predicted maltose transporter MalT
	Patl_2186	cgt	Cyclomaltodextrin glucanotransferase EC=2.4.1.19
Position: -95 Score: 5.4 Sequence: TGATGAATACGTATGTAGGG Locus tag: Patl_2340 Name: amyA Funciton: Alpha-amylase (EC 3.2.1.1) Locus tag: Patl_2339 Name: pulA2 Funciton: Putative pullulanase (Alpha-dextrin endo-1,6-alpha-glucosidase) EC=3.2.1.41 Locus tag: Patl_2338 Name: aglA Funciton: Alpha-glucosidase (EC 3.2.1.20)
	Patl_2340	amyA	Alpha-amylase (EC 3.2.1.1)
	Patl_2339	pulA2	Putative pullulanase (Alpha-dextrin endo-1,6-alpha-glucosidase) EC=3.2.1.41
	Patl_2338	aglA	Alpha-glucosidase (EC 3.2.1.20)
Position: -167 Score: 6 Sequence: TGTTGAATACGTATGCAGTG Locus tag: Patl_1940 Name: omp(Mal)2 Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent Locus tag: Patl_1941 Name: pulA Funciton: Alpha-1,6-glucosidases, pullulanase-type
	Patl_1940	omp(Mal)2	Predicted maltose-specific outer membrane transporter, TonB-dependent
	Patl_1941	pulA	Alpha-1,6-glucosidases, pullulanase-type
Position: -131 Score: 5.8 Sequence: ATTTACATACGTATTCATTT Locus tag: Patl_2859 Name: amyA2 Funciton: Alpha-amylase precursor (EC 3.2.1.1)
	Patl_2859	amyA2	Alpha-amylase precursor (EC 3.2.1.1)
Position: -144 Score: 6.2 Sequence: TACTGAATACGTATGCAAGA Locus tag: Patl_1938 Name: omp(Mal) Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent Locus tag: Patl_1939 Name: trpH Funciton: Tryptophan halogenase
	Patl_1938	omp(Mal)	Predicted maltose-specific outer membrane transporter, TonB-dependent
	Patl_1939	trpH	Tryptophan halogenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of MalR in Pseudoalteromonas atlantica T6c

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --