Regulon of MalR in Colwellia psychrerythraea 34H

Properties
Regulator type:	Transcription factor
TF locus tag:	CPS_0974
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Alteromonadales
Statistics of regulated genes:
- Genes	10
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -129 Score: 5.5 Sequence: TTATGAATACGTATGTAGGG Locus tag: CPS_3370 Name: amyA3 Funciton: Alpha-amylase precursor (EC 3.2.1.1)
	CPS_3370	amyA3	Alpha-amylase precursor (EC 3.2.1.1)
Position: -219 Score: 5.7 Sequence: TAGTGAATACGTATGTAACA Locus tag: CPS_0975 Name: malT Funciton: Predicted maltose transporter MalT
	CPS_0975	malT	Predicted maltose transporter MalT
Position: -162 Score: 5.7 Sequence: CTTTGCATACGTATGTATAA Position: -131 Score: 6.1 Sequence: AATTGCATACGTATGTAATA Position: -91 Score: 6 Sequence: CCTTGCATACGTATTCAAGA Locus tag: CPS_0983 Name: aglA Funciton: Alpha-glucosidase (EC 3.2.1.20) Locus tag: CPS_0982 Name: glk Funciton: Glucokinase (EC 2.7.1.2)
	CPS_0983	aglA	Alpha-glucosidase (EC 3.2.1.20)
	CPS_0982	glk	Glucokinase (EC 2.7.1.2)
Position: -129 Score: 6.3 Sequence: TTTTGAATACGTATGCAAAA Locus tag: CPS_1693 Name: omp(Mal)2 Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent Locus tag: CPS_1694 Name: pulA Funciton: Alpha-1,6-glucosidases, pullulanase-type
	CPS_1693	omp(Mal)2	Predicted maltose-specific outer membrane transporter, TonB-dependent
	CPS_1694	pulA	Alpha-1,6-glucosidases, pullulanase-type
Position: -94 Score: 5.7 Sequence: GCTTGAATACGTATGTAAGA Locus tag: CPS_0996 Name: pulA Funciton: Alpha-1,6-glucosidases, pullulanase-type
	CPS_0996	pulA	Alpha-1,6-glucosidases, pullulanase-type
Position: -220 Score: 6 Sequence: TCTTGAATACGTATGCAAGG Position: -180 Score: 6.1 Sequence: TATTACATACGTATGCAATT Position: -149 Score: 5.7 Sequence: TTATACATACGTATGCAAAG Locus tag: CPS_0984 Name: malZ Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
	CPS_0984	malZ	Maltodextrin glucosidase (EC 3.2.1.20)
Position: -207 Score: 5.9 Sequence: CGTTGCATACGTATTCAATG Position: -166 Score: 5.8 Sequence: CTCTGAATACGTATGCAACG Locus tag: CPS_0993 Name: omp(Mal) Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent Locus tag: CPS_0992 Name: trpH Funciton: Tryptophan halogenase
	CPS_0993	omp(Mal)	Predicted maltose-specific outer membrane transporter, TonB-dependent
	CPS_0992	trpH	Tryptophan halogenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD