Regulon of MalR in Alteromonas macleodii 'Deep ecotype'

Properties
Regulator type:	Transcription factor
TF locus tag:	MADE_01891
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR - Alteromonadales
Statistics of regulated genes:
- Genes	12
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 44 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 5.2 Sequence: TATTGCAATCGTATTCAGAT Locus tag: MADE_01251 Name: malQ Funciton: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25) Locus tag: MADE_01252 Name: glgB Funciton: 1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18) Locus tag: MADE_01253 Name: glgX Funciton: Glycogen debranching enzyme (EC 3.2.1.-)
	MADE_01251	malQ	4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
	MADE_01252	glgB	1,4-alpha-glucan (glycogen) branching enzyme, GH-13-type (EC 2.4.1.18)
	MADE_01253	glgX	Glycogen debranching enzyme (EC 3.2.1.-)
Position: -97 Score: 5.5 Sequence: CGGTGAATACGTATGCAGAG Locus tag: MADE_01888 Name: susA Funciton: Neopullulanase (EC 3.2.1.135) Locus tag: MADE_01889 Name: malT Funciton: Predicted maltose transporter MalT Locus tag: MADE_01890 Name: cgt Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
	MADE_01888	susA	Neopullulanase (EC 3.2.1.135)
	MADE_01889	malT	Predicted maltose transporter MalT
	MADE_01890	cgt	Cyclomaltodextrin glucanotransferase EC=2.4.1.19
Position: -134 Score: 6.1 Sequence: TATTGAATACGTATGCAGGC Locus tag: MADE_01879 Name: omp(Mal) Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent Locus tag: MADE_01880 Name: trpH Funciton: Tryptophan halogenase
	MADE_01879	omp(Mal)	Predicted maltose-specific outer membrane transporter, TonB-dependent
	MADE_01880	trpH	Tryptophan halogenase
Position: -130 Score: 6 Sequence: TTTTGAATACGTATGCATGT Locus tag: MADE_01887 Name: amyA Funciton: Alpha-amylase (EC 3.2.1.1)
	MADE_01887	amyA	Alpha-amylase (EC 3.2.1.1)
Position: -120 Score: 4.9 Sequence: CAATGAATACGTATGTTTAT Locus tag: MADE_03950 Name: aglA Funciton: Alpha-glucosidase (EC 3.2.1.20)
	MADE_03950	aglA	Alpha-glucosidase (EC 3.2.1.20)
Position: -130 Score: 5.7 Sequence: AAATGAATACGTATGCACAG Locus tag: MADE_01881 Name: omp(Mal)2 Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent Locus tag: MADE_01882 Name: pulA Funciton: Alpha-1,6-glucosidases, pullulanase-type
	MADE_01881	omp(Mal)2	Predicted maltose-specific outer membrane transporter, TonB-dependent
	MADE_01882	pulA	Alpha-1,6-glucosidases, pullulanase-type

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD