Regulon of SMb20717 in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL4175
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMb20717 - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -130 Score: 6.2 Sequence: CTATGTAAACCTTTACATAC Position: -109 Score: 5.8 Sequence: TCGTGTAAAGGTTTACATCG Locus tag: RL4175 Name: SMb20717 Funciton: Transcriptional regulator, LacI family
	RL4175	SMb20717	Transcriptional regulator, LacI family
Position: -80 Score: 5.8 Sequence: CGATGTAAACCTTTACACGA Position: -59 Score: 6.2 Sequence: GTATGTAAAGGTTTACATAG Locus tag: RL4174 Name: SMb20718 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: RL4173 Name: SMb20719 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: RL4172 Name: SMb20720 Funciton: Sugar ABC transporter, substrate-binding protein
	RL4174	SMb20718	Sugar ABC transporter, ATP-binding protein
	RL4173	SMb20719	Sugar ABC transporter, inner membrane protein
	RL4172	SMb20720	Sugar ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD