Regulog SMb20717 - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | 4 | 2 |
| Rhizobium leguminosarum bv. viciae 3841 | 4 | 2 |
| Rhizobium sp. NGR234 | 4 | 2 |
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | 4 | 2 |
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| SMb20718 |
Gene: Atu3200: Sugar ABC transporter, ATP-binding protein |
|
|
|
|
Gene: BMEI1392: Sugar ABC transporter, ATP-binding protein |
|
|
|
*
Rhizobium etli CFN 42 Site: position = -158 score = 6.06827 sequence = CGATGTAAAGGTTTACATGA Site: position = -179 score = 6.09095 sequence = CGATGTAAACCTTTACATGC Gene: RHE_CH03646: Sugar ABC transporter, ATP-binding protein |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -80 score = 5.82248 sequence = CGATGTAAACCTTTACACGA Site: position = -59 score = 6.24112 sequence = GTATGTAAAGGTTTACATAG Gene: RL4174: Sugar ABC transporter, ATP-binding protein |
*
Rhizobium sp. NGR234 Site: position = -53 score = 5.57317 sequence = TAGTGTAAAGGTTTACATCA Site: position = -75 score = 5.68897 sequence = TGATGTAAACCTTTACAGTG Gene: NGR_b14990: Sugar ABC transporter, ATP-binding protein |
|
*
Sinorhizobium meliloti 1021 Site: position = -78 score = 6.20256 sequence = TTATGTAAACCTTTACATCG Site: position = -57 score = 5.47744 sequence = GAGTGTAAAGGTTTACATGA Gene: SMb20718: Sugar ABC transporter, ATP-binding protein |
|
Sugar ABC transporter, ATP-binding protein |
| SMb20719 |
Gene: Atu3199: Sugar ABC transporter, inner membrane protein |
|
|
|
|
Gene: BMEI1391: Sugar ABC transporter, inner membrane protein |
|
|
|
Gene: RHE_CH03645: Sugar ABC transporter, inner membrane protein |
Gene: RL4173: Sugar ABC transporter, inner membrane protein |
Gene: NGR_b15000: Sugar ABC transporter, inner membrane protein |
|
Gene: SMb20719: Sugar ABC transporter, inner membrane protein |
|
Sugar ABC transporter, inner membrane protein |
| SMb20720 |
Gene: Atu3198: Sugar ABC transporter, substrate-binding protein |
|
|
|
|
Gene: BMEI1390: Sugar ABC transporter, substrate-binding protein |
|
|
|
Gene: RHE_CH03644: Sugar ABC transporter, substrate-binding protein |
Gene: RL4172: Sugar ABC transporter, substrate-binding protein |
Gene: NGR_b15010: Sugar ABC transporter, substrate-binding protein |
|
Gene: SMb20720: Sugar ABC transporter, substrate-binding protein |
|
Sugar ABC transporter, substrate-binding protein |
| CRON 2. | ||||||||||||||||
| SMb20717 |
|
|
|
|
|
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -131 score = 6.06827 sequence = TCATGTAAACCTTTACATCG Site: position = -110 score = 6.09095 sequence = GCATGTAAAGGTTTACATCG Gene: RHE_CH03647: Transcriptional regulator, LacI family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -130 score = 6.24112 sequence = CTATGTAAACCTTTACATAC Site: position = -109 score = 5.82248 sequence = TCGTGTAAAGGTTTACATCG Gene: RL4175: Transcriptional regulator, LacI family |
*
Rhizobium sp. NGR234 Site: position = -131 score = 5.57317 sequence = TGATGTAAACCTTTACACTA Site: position = -109 score = 5.68897 sequence = CACTGTAAAGGTTTACATCA Gene: NGR_b14980: Transcriptional regulator, LacI family |
|
*
Sinorhizobium meliloti 1021 Site: position = -208 score = 6.20256 sequence = CGATGTAAAGGTTTACATAA Site: position = -229 score = 5.47744 sequence = TCATGTAAACCTTTACACTC Gene: SMb20717: Transcriptional regulator, LacI family |
|
Transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |