Regulon of Jann_3936 in Jannaschia sp. CCS1

Properties
Regulator type:	Transcription factor
TF locus tag:	Jann_3936
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Jann_3936 - Rhodobacterales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -192 Score: 5.5 Sequence: GATTTTAAACGTTTCAATAG Position: -63 Score: 6.4 Sequence: GATTTATAACGTTTTAATTC Locus tag: Jann_3935 Name: RL4252 Funciton: sugar ABC transporter, substrate-binding component Locus tag: Jann_3934 Name: RL4251 Funciton: sugar ABC transporter, permease protein Locus tag: Jann_3933 Name: RL4250 Funciton: putative ABC transporter, permease protein Locus tag: Jann_3932 Name: null Funciton: sugar ABC transporter, ATP-binding protein
	Jann_3935	RL4252	sugar ABC transporter, substrate-binding component
	Jann_3934	RL4251	sugar ABC transporter, permease protein
	Jann_3933	RL4250	putative ABC transporter, permease protein
	Jann_3932		sugar ABC transporter, ATP-binding protein
Position: -194 Score: 6.4 Sequence: GAATTAAAACGTTATAAATC Position: -65 Score: 5.5 Sequence: CTATTGAAACGTTTAAAATC Locus tag: Jann_3936 Name: Jann_3936 Funciton: Transcriptional regulator, LacI family
	Jann_3936	Jann_3936	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD