Regulog Jann_3936 - Rhodobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Statistics of regulated genes
Genome	Genes	Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1	5	2
Loktanella vestfoldensis SKA53
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597
Oceanicola granulosus HTCC2516
Paracoccus denitrificans PD1222
Rhodobacter sphaeroides 2.4.1
Rhodobacterales bacterium HTCC2654
Roseobacter sp. MED193
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Sulfitobacter sp. EE-36

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
Jann_3936	Hyphomonas neptunium ATCC 15444	* Jannaschia sp. CCS1 Site: position = -194 score = 6.41471 sequence = GAATTAAAACGTTATAAATC Site: position = -65 score = 5.54559 sequence = CTATTGAAACGTTTAAAATC Gene: Jann_3936: Transcriptional regulator, LacI family	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Transcriptional regulator, LacI family

CRON 2.
RL4252	Hyphomonas neptunium ATCC 15444	* Jannaschia sp. CCS1 Site: position = -63 score = 6.41471 sequence = GATTTATAACGTTTTAATTC Site: position = -192 score = 5.54559 sequence = GATTTTAAACGTTTCAATAG Gene: Jann_3935: sugar ABC transporter, substrate-binding component	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	sugar ABC transporter, substrate-binding component
RL4251	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1 Gene: Jann_3934: sugar ABC transporter, permease protein	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	sugar ABC transporter, permease protein
RL4250	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1 Gene: Jann_3933: putative ABC transporter, permease protein	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	putative ABC transporter, permease protein
RL4249	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1 Gene: Jann_3932: sugar ABC transporter, ATP-binding protein	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	sugar ABC transporter, ATP-binding protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Jann_3936 - Rhodobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --