Regulog Jann_3936 - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Hyphomonas neptunium ATCC 15444 | ||
| Jannaschia sp. CCS1 | 5 | 2 |
| Loktanella vestfoldensis SKA53 | ||
| Oceanicaulis alexandrii HTCC2633 | ||
| Oceanicola batsensis HTCC2597 | ||
| Oceanicola granulosus HTCC2516 | ||
| Paracoccus denitrificans PD1222 | ||
| Rhodobacter sphaeroides 2.4.1 | ||
| Rhodobacterales bacterium HTCC2654 | ||
| Roseobacter sp. MED193 | ||
| Roseovarius nubinhibens ISM | ||
| Roseovarius sp. 217 | ||
| Silicibacter TM1040 | ||
| Silicibacter pomeroyi DSS-3 | ||
| Sulfitobacter sp. EE-36 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| Jann_3936 |
|
*
Jannaschia sp. CCS1 Site: position = -194 score = 6.41471 sequence = GAATTAAAACGTTATAAATC Site: position = -65 score = 5.54559 sequence = CTATTGAAACGTTTAAAATC Gene: Jann_3936: Transcriptional regulator, LacI family |
|
|
|
|
|
|
|
|
|
|
|
|
|
Transcriptional regulator, LacI family |
| CRON 2. | ||||||||||||||||
| RL4252 |
|
*
Jannaschia sp. CCS1 Site: position = -63 score = 6.41471 sequence = GATTTATAACGTTTTAATTC Site: position = -192 score = 5.54559 sequence = GATTTTAAACGTTTCAATAG Gene: Jann_3935: sugar ABC transporter, substrate-binding component |
|
|
|
|
|
|
|
|
|
|
|
|
|
sugar ABC transporter, substrate-binding component |
| RL4251 |
|
Gene: Jann_3934: sugar ABC transporter, permease protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
sugar ABC transporter, permease protein |
| RL4250 |
|
Gene: Jann_3933: putative ABC transporter, permease protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
putative ABC transporter, permease protein |
| RL4249 |
|
Gene: Jann_3932: sugar ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
sugar ABC transporter, ATP-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |