Regulon of RL4253 in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_c33050
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	RL4253 - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -129 Score: 6.2 Sequence: GATTTGTAACGTTTTAAATT Locus tag: NGR_c33060 Name: RL4252 Funciton: sugar ABC transporter, substrate-binding component Locus tag: NGR_c33070 Name: RL4251 Funciton: sugar ABC transporter, permease protein Locus tag: NGR_c33080 Name: RL4250 Funciton: sugar ABC transporter, permease protein Locus tag: NGR_c33090 Name: RL4249 Funciton: sugar ABC transporter, ATP-binding protein Locus tag: NGR_c33110 Name: COG2303 Funciton: Choline dehydrogenase and related flavoproteins
	NGR_c33060	RL4252	sugar ABC transporter, substrate-binding component
	NGR_c33070	RL4251	sugar ABC transporter, permease protein
	NGR_c33080	RL4250	sugar ABC transporter, permease protein
	NGR_c33090	RL4249	sugar ABC transporter, ATP-binding protein
	NGR_c33110	COG2303	Choline dehydrogenase and related flavoproteins
Position: -225 Score: 6.2 Sequence: AATTTAAAACGTTACAAATC Position: -88 Score: 5 Sequence: GATTTAAAACGTTTGCATCA Locus tag: NGR_c33050 Name: RL4253 Funciton: Transcriptional regulator, LacI family
	NGR_c33050	RL4253	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD