Regulon of RL4253 in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL4253
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	RL4253 - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -245 Score: 6.1 Sequence: GAATGGAAACGTTTTAAATT Position: -124 Score: 6.4 Sequence: GATTTATAACGTTTTAAATT Locus tag: RL4252 Name: RL4252 Funciton: sugar ABC transporter, substrate-binding component Locus tag: RL4251 Name: RL4251 Funciton: sugar ABC transporter, permease protein Locus tag: RL4250 Name: RL4250 Funciton: sugar ABC transporter, permease protein Locus tag: RL4249 Name: RL4249 Funciton: sugar ABC transporter, ATP-binding protein
	RL4252	RL4252	sugar ABC transporter, substrate-binding component
	RL4251	RL4251	sugar ABC transporter, permease protein
	RL4250	RL4250	sugar ABC transporter, permease protein
	RL4249	RL4249	sugar ABC transporter, ATP-binding protein
Position: -203 Score: 6.4 Sequence: AATTTAAAACGTTATAAATC Position: -82 Score: 6.1 Sequence: AATTTAAAACGTTTCCATTC Locus tag: RL4253 Name: RL4253 Funciton: Transcriptional regulator, LacI family
	RL4253	RL4253	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD