Regulon of RL4253 in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_CH03710
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	RL4253 - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -244 Score: 6.1 Sequence: CAATGAAAACGTTTTAAATT Position: -123 Score: 5.8 Sequence: GGCTTATAACGTTTTAAATT Locus tag: RHE_CH03709 Name: RL4252 Funciton: sugar ABC transporter, substrate-binding component Locus tag: RHE_CH03708 Name: RL4251 Funciton: sugar ABC transporter, permease protein Locus tag: RHE_CH03707 Name: RL4250 Funciton: sugar ABC transporter, permease protein Locus tag: RHE_CH03706 Name: RL4249 Funciton: sugar ABC transporter, ATP-binding protein
	RHE_CH03709	RL4252	sugar ABC transporter, substrate-binding component
	RHE_CH03708	RL4251	sugar ABC transporter, permease protein
	RHE_CH03707	RL4250	sugar ABC transporter, permease protein
	RHE_CH03706	RL4249	sugar ABC transporter, ATP-binding protein
Position: -202 Score: 5.8 Sequence: AATTTAAAACGTTATAAGCC Position: -81 Score: 6.1 Sequence: AATTTAAAACGTTTTCATTG Locus tag: RHE_CH03710 Name: RL4253 Funciton: Transcriptional regulator, LacI family
	RHE_CH03710	RL4253	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD