Regulon of CadR-PbrR in Mesorhizobium sp. BNC1

Properties
Regulator type:	Transcription factor
TF locus tag:	Meso_4426, Meso_4119, Meso_2848, Meso_4217
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog:	CadR-PbrR - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -280 Score: 5 Sequence: ATTCTTTAGTGGCTACAGAAT Position: -64 Score: 4.4 Sequence: ATTCTGTAGTGGCCACAGGAA Locus tag: Meso_4216 Name: PF00501 Funciton: Coenzyme F390 synthetase Locus tag: Meso_4214 Name: czcD Funciton: Co/Zn/Cd efflux protein
	Meso_4216	PF00501	Coenzyme F390 synthetase
	Meso_4214	czcD	Co/Zn/Cd efflux protein
Position: -34 Score: 5.1 Sequence: ATGCTTTAGTCGCCAGAGGAT Locus tag: Meso_4426 Name: cadR2 Funciton: Cadmium resistance transcriptional regulator, MerR family Locus tag: Meso_4425 Name: null Funciton: hypothetical protein Locus tag: Meso_4424 Name: czcD Funciton: Co/Zn/Cd efflux protein
	Meso_4426	cadR2	Cadmium resistance transcriptional regulator, MerR family
	Meso_4425		hypothetical protein
	Meso_4424	czcD	Co/Zn/Cd efflux protein
Position: -57 Score: 5.3 Sequence: ACCCTCTAGCTGCTATAGGTC Locus tag: Meso_4129 Name: cadA2 Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
	Meso_4129	cadA2	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Position: -57 Score: 6.2 Sequence: CTCCTATAGTCACTAGAGGAA Locus tag: Meso_2849 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
	Meso_2849	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD