Regulog CadR-PbrR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Sinorhizobium meliloti 1021 | 1 | 1 |
| Rhizobium sp. NGR234 | 1 | 1 |
| Rhizobium leguminosarum bv. viciae 3841 | 1 | 1 |
| Rhizobium etli CFN 42 | 1 | 1 |
| Agrobacterium tumefaciens str. C58 (Cereon) | 4 | 2 |
| Mesorhizobium sp. BNC1 | 7 | 4 |
| Mesorhizobium loti MAFF303099 | 1 | 1 |
| Brucella melitensis 16M | 1 | 1 |
| Bartonella quintana str. Toulouse | ||
| Rhodopseudomonas palustris CGA009 | 1 | 1 |
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | 1 | 1 |
| Nitrobacter winogradskyi Nb-255 | 1 | 1 |
| Azorhizobium caulinodans ORS 571 | 1 | 1 |
| Xanthobacter autotrophicus Py2 | 2 | 2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| cadA2 |
|
|
|
|
|
*
Mesorhizobium sp. BNC1 Site: position = -57 score = 5.33082 sequence = ACCCTCTAGCTGCTATAGGTC Gene: Meso_4129: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
|
|
|
|
|
|
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
| CRON 2. | ||||||||||||||||
| cadA |
*
Sinorhizobium meliloti 1021 Site: position = -54 score = 6.04897 sequence = AACCTCTAGCCGCTAGAGGAC Gene: SMc04128: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Rhizobium sp. NGR234 Site: position = -54 score = 6.01407 sequence = TAGCTCTAGTCGCTAGAGGTT Gene: NGR_c34490: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -58 score = 6.30619 sequence = CACCTCTAGTCGCTAGAGGAT Gene: RL4262: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Rhizobium etli CFN 42 Site: position = -58 score = 6.30619 sequence = CACCTCTAGTCGCTAGAGGAT Gene: RHE_CH03719: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -59 score = 5.82877 sequence = AAGCTCTAGTTGCTAGAGGTG Gene: Atu0843: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Mesorhizobium sp. BNC1 Site: position = -57 score = 6.17812 sequence = CTCCTATAGTCACTAGAGGAA Gene: Meso_2849: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Mesorhizobium loti MAFF303099 Site: position = -97 score = 6.06751 sequence = AAGCTCTAGTGACTAGAGCAA Gene: mll2475: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Brucella melitensis 16M Site: position = -63 score = 6.33603 sequence = CTCCTCTAGTTACTAGAGGAT Gene: BMEI0053: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
*
Rhodopseudomonas palustris CGA009 Site: position = -59 score = 4.64605 sequence = ACCCTGTAGCCGCTACAGGGT Gene: RPA3260: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
*
Bradyrhizobium sp. BTAi1 Site: position = -46 score = 6.18954 sequence = CTCCTCTAGCGACTAGAGGAC Gene: BBta_7421: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Nitrobacter winogradskyi Nb-255 Site: position = -59 score = 5.11923 sequence = ACCCTATAGTTACTACAGGGT Gene: Nwi_3134: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*
Azorhizobium caulinodans ORS 571 Site: position = -55 score = 6.37302 sequence = CTCCTCTAGTGACTAGAGGAC Gene: AZC_1456: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
*2
Xanthobacter autotrophicus Py2 Site: position = -28 score = 6.03519 sequence = CTCCTCTAGTGACTAGAGTAT Gene: Xaut_3978: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Site: position = -28 score = 6.03519 sequence = CTCCTCTAGTGACTAGAGTAT Gene: Xaut_3338: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
| CRON 3. | ||||||||||||||||
| cadR2 |
|
|
|
|
|
*
Mesorhizobium sp. BNC1 Site: position = -34 score = 5.13025 sequence = ATGCTTTAGTCGCCAGAGGAT Gene: Meso_4426: Cadmium resistance transcriptional regulator, MerR family |
|
|
|
|
|
|
|
|
|
Cadmium resistance transcriptional regulator, MerR family |
| Meso_4425 |
|
|
|
|
|
Gene: Meso_4425: hypothetical protein |
|
|
|
|
|
|
|
|
|
hypothetical protein |
| czcD |
Gene: SMc04167: Co/Zn/Cd efflux protein |
|
Gene: RL1351: Co/Zn/Cd efflux protein |
Gene: RHE_CH01219: Co/Zn/Cd efflux protein |
Gene: Atu0891: Co/Zn/Cd efflux protein |
3
Mesorhizobium sp. BNC1 Gene: Meso_0755: Co/Zn/Cd efflux protein Gene: Meso_4214: Co/Zn/Cd efflux protein Gene: Meso_4424: Co/Zn/Cd efflux protein |
|
|
|
|
Gene: bll5050: Co/Zn/Cd efflux protein |
Gene: BBta_4663: Co/Zn/Cd efflux protein |
|
|
|
Co/Zn/Cd efflux protein |
| Atu0889 |
|
|
|
|
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -20 score = 5.23699 sequence = TATCTCCAGTCTCTAGAGATA Gene: Atu0889: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| PF02583 |
Gene: SMc04168: hypothetical protein |
|
Gene: RL1350: hypothetical protein |
Gene: RHE_CH01218: hypothetical protein |
Gene: Atu0890: hypothetical protein |
Gene: Meso_0756: hypothetical protein |
|
|
|
|
|
|
|
|
|
hypothetical protein |
| PF00501 |
|
|
|
|
|
*
Mesorhizobium sp. BNC1 Site: position = -64 score = 4.4297 sequence = ATTCTGTAGTGGCCACAGGAA Site: position = -280 score = 4.96872 sequence = ATTCTTTAGTGGCTACAGAAT Gene: Meso_4216: Coenzyme F390 synthetase |
|
|
|
|
|
|
|
|
|
Coenzyme F390 synthetase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |