Regulon of CadR-PbrR in Acinetobacter sp. ADP1
Regulator type: | Transcription factor |
TF locus tag: | ACIAD3599 |
Regulator family: | MerR |
Regulation mode: | activator |
Biological process: | Lead resistance; Cadmium resistance |
Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
Regulog: | CadR-PbrR - Moraxellaceae |
Statistics of regulated genes: | |
- Genes | 1 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Moraxellaceae
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
Locus Tag | Name | Function | |
---|---|---|---|
Position: -51
Score: 4.9 Sequence: ACCTTGGAGTGACTCCAGCCT
Locus tag: ACIAD3600
Name: czcD Funciton: Co/Zn/Cd efflux protein |
|||
czcD
|
Co/Zn/Cd efflux protein
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |