Regulog CadR-PbrR - Moraxellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
czcD2	Acinetobacter sp. ADP1	* Acinetobacter baumannii AB0057 Site: position = -61 score = 5.24334 sequence = ACATTATAGCTACTATATAGT Gene: AB57_0301: Co/Zn/Cd efflux protein	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Co/Zn/Cd efflux protein
lspA	Acinetobacter sp. ADP1	Acinetobacter baumannii AB0057 Gene: AB57_0302: Lipoprotein signal peptidase (EC 3.4.23.36)	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Lipoprotein signal peptidase (EC 3.4.23.36)

CRON 2.
czcD	* Acinetobacter sp. ADP1 Site: position = -51 score = 4.88949 sequence = ACCTTGGAGTGACTCCAGCCT Gene: ACIAD3600: Co/Zn/Cd efflux protein	* Acinetobacter baumannii AB0057 Site: position = -57 score = 5.37744 sequence = ACTCTGGAGCTACTCAAGGGT Gene: AB57_1125: Co/Zn/Cd efflux protein	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Co/Zn/Cd efflux protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --