Regulog CadR-PbrR - Moraxellaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Moraxellaceae
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Acinetobacter sp. ADP1 | 1 | 1 |
| Acinetobacter baumannii AB0057 | 3 | 2 |
| Psychrobacter arcticum 273-4 | ||
| Psychrobacter sp. PRwf-1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| czcD2 |
|
*
Acinetobacter baumannii AB0057 Site: position = -61 score = 5.24334 sequence = ACATTATAGCTACTATATAGT Gene: AB57_0301: Co/Zn/Cd efflux protein |
|
|
Co/Zn/Cd efflux protein |
| lspA |
|
Gene: AB57_0302: Lipoprotein signal peptidase (EC 3.4.23.36) |
|
|
Lipoprotein signal peptidase (EC 3.4.23.36) |
| CRON 2. | |||||
| czcD |
*
Acinetobacter sp. ADP1 Site: position = -51 score = 4.88949 sequence = ACCTTGGAGTGACTCCAGCCT Gene: ACIAD3600: Co/Zn/Cd efflux protein |
*
Acinetobacter baumannii AB0057 Site: position = -57 score = 5.37744 sequence = ACTCTGGAGCTACTCAAGGGT Gene: AB57_1125: Co/Zn/Cd efflux protein |
|
|
Co/Zn/Cd efflux protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |