Regulon of CadR-PbrR in Saccharophagus degradans 2-40

Properties
Regulator type:	Transcription factor
TF locus tag:	Sde_1961
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog:	CadR-PbrR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 6.3 Sequence: ACTCTATAGTTACTATAGAGT Locus tag: Sde_1960 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: Sde_1959 Name: null Funciton: hypothetical protein Locus tag: Sde_1958 Name: czcC Funciton: Heavy metal efflux RND outer membrane protein Locus tag: Sde_1957 Name: null Funciton: hypothetical protein Locus tag: Sde_1956 Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein Locus tag: Sde_1955 Name: czcA Funciton: Heavy metal efflux RND transmembrane protein
	Sde_1960	czcD	Co/Zn/Cd efflux protein
	Sde_1959		hypothetical protein
	Sde_1958	czcC	Heavy metal efflux RND outer membrane protein
	Sde_1957		hypothetical protein
	Sde_1956	czcB	Heavy metal efflux RND transporter, membrane fusion protein
	Sde_1955	czcA	Heavy metal efflux RND transmembrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD