Regulog CadR-PbrR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Hahella chejuensis KCTC 2396 | 1 | 1 |
| Marinobacter aqueolei | 13 | 7 |
| Marinobacter sp. ELB17 | 1 | 1 |
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | 1 | 1 |
| Marinomonas sp. MWYL1 | ||
| Saccharophagus degradans 2-40 | 6 | 1 |
| Teredinibacter turnerae T7901 | ||
| Cellvibrio japonicus Ueda107 | 5 | 1 |
| Chromohalobacter salexigens DSM 3043 | ||
| Reinekea sp. MED297 | ||
| Alcanivorax borkumensis SK2 | 2 | 1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| czcD |
|
|
|
|
|
|
*
Saccharophagus degradans 2-40 Site: position = -57 score = 6.29717 sequence = ACTCTATAGTTACTATAGAGT Gene: Sde_1960: Co/Zn/Cd efflux protein |
|
*
Cellvibrio japonicus Ueda107 Site: position = -63 score = 6.1543 sequence = ACCCTCTAGTAACTATAGAGT Gene: CJA_1839: Co/Zn/Cd efflux protein |
|
|
|
Co/Zn/Cd efflux protein |
| Sde_1959 |
|
|
|
|
|
|
Gene: Sde_1959: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| czcC |
|
|
|
|
|
|
Gene: Sde_1958: Heavy metal efflux RND outer membrane protein |
|
2
Cellvibrio japonicus Ueda107 Gene: CJA_1841: Heavy metal efflux RND outer membrane protein Gene: CJA_3697: Heavy metal efflux RND outer membrane protein |
|
|
Gene: ABO_1379: Heavy metal efflux RND outer membrane protein |
Heavy metal efflux RND outer membrane protein |
| Sde_1957 |
|
|
|
|
|
|
Gene: Sde_1957: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| czcB |
|
|
|
|
|
|
Gene: Sde_1956: Heavy metal efflux RND transporter, membrane fusion protein |
|
2
Cellvibrio japonicus Ueda107 Gene: CJA_1842: Heavy metal efflux RND transporter, membrane fusion protein Gene: CJA_3696: Heavy metal efflux RND transporter, membrane fusion protein |
|
|
Gene: ABO_1378: Heavy metal efflux RND transporter, membrane fusion protein |
Heavy metal efflux RND transporter, membrane fusion protein |
| czcA |
|
|
|
|
|
|
Gene: Sde_1955: Heavy metal efflux RND transmembrane protein |
|
2
Cellvibrio japonicus Ueda107 Gene: CJA_1843: Heavy metal efflux RND transmembrane protein Gene: CJA_3695: Heavy metal efflux RND transmembrane protein |
|
|
Gene: ABO_1377: Heavy metal efflux RND transmembrane protein |
Heavy metal efflux RND transmembrane protein |
| CJA_1840 |
|
|
|
|
|
|
|
|
Gene: CJA_1840: hypothetical protein |
|
|
|
hypothetical protein |
| CRON 2. | |||||||||||||
| czcD |
*
Hahella chejuensis KCTC 2396 Site: position = -58 score = 5.54752 sequence = ACCCTGTAGCGACTCCAGACT Gene: HCH_03680: Co/Zn/Cd efflux protein |
*
Marinobacter aqueolei Site: position = -55 score = 6.58312 sequence = ACCCTGTAGCAACTACAGGGT Gene: Maqu_3109: Co/Zn/Cd efflux protein |
*
Marinobacter sp. ELB17 Site: position = -57 score = 6.58312 sequence = ACCCTGTAGCTACTACAGGGT Gene: MELB17_04522: Co/Zn/Cd efflux protein |
|
*
Oceanospirillum sp. MED92 Site: position = -59 score = 6.52076 sequence = ACCCTATAGCTACTACAGGGT Gene: MED92_00235: Co/Zn/Cd efflux protein |
|
|
|
|
Gene: Csal_1006: Co/Zn/Cd efflux protein |
|
|
Co/Zn/Cd efflux protein |
| CRON 3. | |||||||||||||
| czcD2 |
|
*7
Marinobacter aqueolei Gene: Maqu_0890: Co/Zn/Cd efflux protein Site: position = -61 score = 5.89667 sequence = ACCTTATAGTGACTATATAGT Gene: Maqu_1408: Co/Zn/Cd efflux protein Site: position = -40 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: Maqu_0893: Co/Zn/Cd efflux protein Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: Maqu_4003: Co/Zn/Cd efflux protein Site: position = -61 score = 6.56058 sequence = ACCCTGTAGTGGCTACAGGGT Gene: Maqu_1294: Co/Zn/Cd efflux protein Site: position = -61 score = 6.56058 sequence = ACCCTGTAGTGGCTACAGGGT Gene: Maqu_3210: Co/Zn/Cd efflux protein Site: position = -61 score = 6.56058 sequence = ACCCTGTAGTGGCTACAGGGT Gene: Maqu_3273: Co/Zn/Cd efflux protein |
|
|
|
|
|
|
|
|
|
*
Alcanivorax borkumensis SK2 Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: ABO_1368: Co/Zn/Cd efflux protein |
Co/Zn/Cd efflux protein |
| PF00665 |
|
Gene: Maqu_0892: ISPsy14, transposase |
|
|
|
|
|
|
|
|
|
|
ISPsy14, transposase |
| PF01695 |
|
Gene: Maqu_0891: Transposase subunit |
|
|
|
|
|
|
|
|
|
|
Transposase subunit |
| lspA |
|
3
Marinobacter aqueolei Gene: Maqu_0889: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Maqu_1409: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Maqu_3274: Lipoprotein signal peptidase (EC 3.4.23.36) |
|
|
|
|
|
|
|
|
|
Gene: ABO_1369: Lipoprotein signal peptidase (EC 3.4.23.36) |
Lipoprotein signal peptidase (EC 3.4.23.36) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |