Regulog CadR-PbrR - Oceanospirillales/Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Statistics of regulated genes
Genome	Genes	Operons
Hahella chejuensis KCTC 2396	1	1
Marinobacter aqueolei	13	7
Marinobacter sp. ELB17	1	1
Oceanobacter sp. RED65
Oceanospirillum sp. MED92	1	1
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40	6	1
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107	5	1
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297
Alcanivorax borkumensis SK2	2	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
czcD	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	* Saccharophagus degradans 2-40 Site: position = -57 score = 6.29717 sequence = ACTCTATAGTTACTATAGAGT Gene: Sde_1960: Co/Zn/Cd efflux protein	Teredinibacter turnerae T7901	* Cellvibrio japonicus Ueda107 Site: position = -63 score = 6.1543 sequence = ACCCTCTAGTAACTATAGAGT Gene: CJA_1839: Co/Zn/Cd efflux protein	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Co/Zn/Cd efflux protein
Sde_1959	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40 Gene: Sde_1959: hypothetical protein	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	hypothetical protein
czcC	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40 Gene: Sde_1958: Heavy metal efflux RND outer membrane protein	Teredinibacter turnerae T7901	2 Cellvibrio japonicus Ueda107 Gene: CJA_1841: Heavy metal efflux RND outer membrane protein Gene: CJA_3697: Heavy metal efflux RND outer membrane protein	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1379: Heavy metal efflux RND outer membrane protein	Heavy metal efflux RND outer membrane protein
Sde_1957	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40 Gene: Sde_1957: hypothetical protein	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	hypothetical protein
czcB	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40 Gene: Sde_1956: Heavy metal efflux RND transporter, membrane fusion protein	Teredinibacter turnerae T7901	2 Cellvibrio japonicus Ueda107 Gene: CJA_1842: Heavy metal efflux RND transporter, membrane fusion protein Gene: CJA_3696: Heavy metal efflux RND transporter, membrane fusion protein	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1378: Heavy metal efflux RND transporter, membrane fusion protein	Heavy metal efflux RND transporter, membrane fusion protein
czcA	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40 Gene: Sde_1955: Heavy metal efflux RND transmembrane protein	Teredinibacter turnerae T7901	2 Cellvibrio japonicus Ueda107 Gene: CJA_1843: Heavy metal efflux RND transmembrane protein Gene: CJA_3695: Heavy metal efflux RND transmembrane protein	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1377: Heavy metal efflux RND transmembrane protein	Heavy metal efflux RND transmembrane protein
CJA_1840	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107 Gene: CJA_1840: hypothetical protein	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	hypothetical protein

CRON 2.
czcD	* Hahella chejuensis KCTC 2396 Site: position = -58 score = 5.54752 sequence = ACCCTGTAGCGACTCCAGACT Gene: HCH_03680: Co/Zn/Cd efflux protein	* Marinobacter aqueolei Site: position = -55 score = 6.58312 sequence = ACCCTGTAGCAACTACAGGGT Gene: Maqu_3109: Co/Zn/Cd efflux protein	* Marinobacter sp. ELB17 Site: position = -57 score = 6.58312 sequence = ACCCTGTAGCTACTACAGGGT Gene: MELB17_04522: Co/Zn/Cd efflux protein	Oceanobacter sp. RED65	* Oceanospirillum sp. MED92 Site: position = -59 score = 6.52076 sequence = ACCCTATAGCTACTACAGGGT Gene: MED92_00235: Co/Zn/Cd efflux protein	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043 Gene: Csal_1006: Co/Zn/Cd efflux protein	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Co/Zn/Cd efflux protein

CRON 3.
czcD2	Hahella chejuensis KCTC 2396	7 Marinobacter aqueolei* Gene: Maqu_0890: Co/Zn/Cd efflux protein Site: position = -61 score = 5.89667 sequence = ACCTTATAGTGACTATATAGT Gene: Maqu_1408: Co/Zn/Cd efflux protein Site: position = -40 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: Maqu_0893: Co/Zn/Cd efflux protein Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: Maqu_4003: Co/Zn/Cd efflux protein Site: position = -61 score = 6.56058 sequence = ACCCTGTAGTGGCTACAGGGT Gene: Maqu_1294: Co/Zn/Cd efflux protein Site: position = -61 score = 6.56058 sequence = ACCCTGTAGTGGCTACAGGGT Gene: Maqu_3210: Co/Zn/Cd efflux protein Site: position = -61 score = 6.56058 sequence = ACCCTGTAGTGGCTACAGGGT Gene: Maqu_3273: Co/Zn/Cd efflux protein	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	* Alcanivorax borkumensis SK2 Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: ABO_1368: Co/Zn/Cd efflux protein	Co/Zn/Cd efflux protein
PF00665	Hahella chejuensis KCTC 2396	Marinobacter aqueolei Gene: Maqu_0892: ISPsy14, transposase	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	ISPsy14, transposase
PF01695	Hahella chejuensis KCTC 2396	Marinobacter aqueolei Gene: Maqu_0891: Transposase subunit	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2	Transposase subunit
lspA	Hahella chejuensis KCTC 2396	3 Marinobacter aqueolei Gene: Maqu_0889: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Maqu_1409: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Maqu_3274: Lipoprotein signal peptidase (EC 3.4.23.36)	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	Reinekea sp. MED297	Alcanivorax borkumensis SK2 Gene: ABO_1369: Lipoprotein signal peptidase (EC 3.4.23.36)	Lipoprotein signal peptidase (EC 3.4.23.36)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CadR-PbrR - Oceanospirillales/Alteromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --