Regulon of CadR-PbrR in Pseudoalteromonas atlantica T6c

Properties
Regulator type:	Transcription factor
TF locus tag:	Patl_2024
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog:	CadR-PbrR - Alteromonadales
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 4.6 Sequence: ACTCTATACTTAGTATAGACT Locus tag: Patl_2025 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: Patl_2026 Name: null Funciton: hypothetical protein Locus tag: Patl_2027 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: Patl_2028 Name: null Funciton: hypothetical protein Locus tag: Patl_2029 Name: czcC Funciton: Heavy metal efflux RND outer membrane protein Locus tag: Patl_2030 Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein Locus tag: Patl_2031 Name: czcA Funciton: Heavy metal efflux RND transmembrane protein
	Patl_2025	czcD	Co/Zn/Cd efflux protein
	Patl_2026		hypothetical protein
	Patl_2027	czcD	Co/Zn/Cd efflux protein
	Patl_2028		hypothetical protein
	Patl_2029	czcC	Heavy metal efflux RND outer membrane protein
	Patl_2030	czcB	Heavy metal efflux RND transporter, membrane fusion protein
	Patl_2031	czcA	Heavy metal efflux RND transmembrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD