Regulog CadR-PbrR - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Pseudoalteromonas atlantica T6c | 7 | 1 |
| Alteromonas macleodii 'Deep ecotype' | ||
| Glaciecola sp. HTCC2999 | 6 | 1 |
| Colwellia psychrerythraea 34H | ||
| Alteromonadales bacterium TW-7 | ||
| Pseudoalteromonas haloplanktis TAC125 | 4 | 1 |
| Pseudoalteromonas tunicata D2 | ||
| Idiomarina baltica OS145 | 10 | 3 |
| Idiomarina loihiensis L2TR | 6 | 3 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| czcD2 |
|
|
|
|
|
|
|
*
Idiomarina baltica OS145 Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: OS145_03978: Co/Zn/Cd efflux protein |
*2
Idiomarina loihiensis L2TR Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: IL1242: Co/Zn/Cd efflux protein Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: IL0632: Co/Zn/Cd efflux protein |
Co/Zn/Cd efflux protein |
| lspA2 |
|
|
|
|
|
|
|
Gene: OS145_03973: Lipoprotein signal peptidase (EC 3.4.23.36) |
2
Idiomarina loihiensis L2TR Gene: IL1241: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: IL0633: Lipoprotein signal peptidase (EC 3.4.23.36) |
Lipoprotein signal peptidase (EC 3.4.23.36) |
| CRON 2. | ||||||||||
| czcD |
*2
Pseudoalteromonas atlantica T6c Site: position = -60 score = 4.56606 sequence = ACTCTATACTTAGTATAGACT Gene: Patl_2025: Co/Zn/Cd efflux protein Gene: Patl_2027: Co/Zn/Cd efflux protein |
Gene: MADE_02030: Co/Zn/Cd efflux protein |
Gene: GHTCC_010100000545: Co/Zn/Cd efflux protein |
|
|
|
|
*2
Idiomarina baltica OS145 Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: OS145_03758: Co/Zn/Cd efflux protein Site: position = -61 score = 5.49582 sequence = ACCTTATAGTAGCTTTATAGT Gene: OS145_01757: Co/Zn/Cd efflux protein |
*
Idiomarina loihiensis L2TR Site: position = -161 score = 5.64006 sequence = ACCTTATAGTAACTTTATAGT Gene: IL1636: Co/Zn/Cd efflux protein |
Co/Zn/Cd efflux protein |
| Patl_2026 |
Gene: Patl_2026: hypothetical protein |
|
*
Glaciecola sp. HTCC2999 Site: position = -78 score = 5.15573 sequence = ACCCTATACTTGGTATAGAGT Gene: GHTCC_010100000540: hypothetical protein |
|
|
|
|
|
|
hypothetical protein |
| Patl_2028 |
Gene: Patl_2028: hypothetical protein |
Gene: MADE_02031: hypothetical protein |
Gene: GHTCC_010100000550: hypothetical protein |
Gene: CPS_2870: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| czcC |
Gene: Patl_2029: Heavy metal efflux RND outer membrane protein |
Gene: MADE_02027: Heavy metal efflux RND outer membrane protein |
Gene: GHTCC_010100000555: Heavy metal efflux RND outer membrane protein |
Gene: CPS_1957: Heavy metal efflux RND outer membrane protein |
Gene: ATW7_03857: Heavy metal efflux RND outer membrane protein |
Gene: PSHAa0577: Heavy metal efflux RND outer membrane protein |
|
Gene: OS145_01742: Heavy metal efflux RND outer membrane protein |
2
Idiomarina loihiensis L2TR Gene: IL0779: Heavy metal efflux RND outer membrane protein Gene: IL1634: Heavy metal efflux RND outer membrane protein |
Heavy metal efflux RND outer membrane protein |
| czcB |
Gene: Patl_2030: Heavy metal efflux RND transporter, membrane fusion protein |
Gene: MADE_02028: Heavy metal efflux RND transporter, membrane fusion protein |
Gene: GHTCC_010100000560: Heavy metal efflux RND transporter, membrane fusion protein |
Gene: CPS_1958: Heavy metal efflux RND transporter, membrane fusion protein |
Gene: ATW7_03862: Heavy metal efflux RND transporter, membrane fusion protein |
Gene: PSHAa0578: Heavy metal efflux RND transporter, membrane fusion protein |
|
Gene: OS145_01737: Heavy metal efflux RND transporter, membrane fusion protein |
2
Idiomarina loihiensis L2TR Gene: IL0778: Heavy metal efflux RND transporter, membrane fusion protein Gene: IL1633: Heavy metal efflux RND transporter, membrane fusion protein |
Heavy metal efflux RND transporter, membrane fusion protein |
| czcA |
Gene: Patl_2031: Heavy metal efflux RND transmembrane protein |
Gene: MADE_02029: Heavy metal efflux RND transmembrane protein |
Gene: GHTCC_010100000565: Heavy metal efflux RND transmembrane protein |
Gene: CPS_1959: Heavy metal efflux RND transmembrane protein |
Gene: ATW7_03867: Heavy metal efflux RND transmembrane protein |
Gene: PSHAa0579: Heavy metal efflux RND transmembrane protein |
|
Gene: OS145_01732: Heavy metal efflux RND transmembrane protein |
2
Idiomarina loihiensis L2TR Gene: IL0777: Heavy metal efflux RND transmembrane protein Gene: IL1632: Heavy metal efflux RND transmembrane protein |
Heavy metal efflux RND transmembrane protein |
| lspA |
|
|
|
|
|
|
|
2
Idiomarina baltica OS145 Gene: OS145_03763: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: OS145_01752: Lipoprotein signal peptidase (EC 3.4.23.36) |
Gene: IL1635: Lipoprotein signal peptidase (EC 3.4.23.36) |
Lipoprotein signal peptidase (EC 3.4.23.36) |
| OS145_01747 |
|
|
|
|
|
|
|
Gene: OS145_01747: hypothetical protein |
Gene: IL0780: hypothetical protein |
hypothetical protein |
| ATW7_03852 |
|
|
|
|
Gene: ATW7_03852: conserved protein of unknown function |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -93 score = 5.18325 sequence = ACCTTCCAGTAACTAGAAGGT Gene: PSHAa0576: conserved protein of unknown function |
|
|
|
conserved protein of unknown function |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |