Regulon of CueR in Acinetobacter baumannii AB0057

Properties
Regulator type:	Transcription factor
TF locus tag:	AB57_1354
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Moraxellaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 5.4 Sequence: ACCTTGTCATGATTGTAAGGT Position: -70 Score: 5.6 Sequence: ACCTTCCCATGATGGGAATCT Locus tag: AB57_1353 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: AB57_1354 Name: cueR Funciton: Copper resistance ranscriptional regulator, MerR family
	AB57_1353	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	AB57_1354	cueR	Copper resistance ranscriptional regulator, MerR family
Position: -123 Score: 5.6 Sequence: AGATTCCCATCATGGGAAGGT Position: -72 Score: 5.4 Sequence: ACCTTACAATCATGACAAGGT Locus tag: AB57_1352 Name: copZ Funciton: Copper chaperone
	AB57_1352	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD