Regulog CueR - Moraxellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
copZ	Acinetobacter sp. ADP1	* Acinetobacter baumannii AB0057 Site: position = -123 score = 5.55858 sequence = AGATTCCCATCATGGGAAGGT Site: position = -72 score = 5.41626 sequence = ACCTTACAATCATGACAAGGT Gene: AB57_1352: Copper chaperone	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Copper chaperone

CRON 2.
copA	Acinetobacter sp. ADP1	* Acinetobacter baumannii AB0057 Site: position = -121 score = 5.41626 sequence = ACCTTGTCATGATTGTAAGGT Site: position = -70 score = 5.55858 sequence = ACCTTCCCATGATGGGAATCT Gene: AB57_1353: Copper-translocating P-type ATPase (EC 3.6.3.4)	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR	Acinetobacter sp. ADP1	Acinetobacter baumannii AB0057 Gene: AB57_1354: Copper resistance ranscriptional regulator, MerR family	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Copper resistance ranscriptional regulator, MerR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --