Regulon of CueR in Ralstonia metallidurans CH34

Properties
Regulator type:	Transcription factor
TF locus tag:	Rmet_3523
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Ralstonia
Statistics of regulated genes:
- Genes	11
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -110 Score: 4.6 Sequence: ACGTTCCTGCCGTGGGAACGT Locus tag: Rmet_6706 Name: null Funciton: hypothetical protein Locus tag: Rmet_5030 Name: cusD Funciton: Heavy metal efflux RND transmembrane protein Locus tag: Rmet_5031 Name: cusC Funciton: Heavy metal efflux RND outer membrane protein, CzcC family Locus tag: Rmet_5032 Name: cusB Funciton: Heavy metal efflux RND transporter, membrane fusion protein, CzcB family Locus tag: Rmet_5033 Name: cusA Funciton: Heavy metal efflux RND transmembrane protein, CzcA family Locus tag: Rmet_5034 Name: cusF Funciton: Heavy metal efflux RND periplasmic protein
	Rmet_6706		hypothetical protein
	Rmet_5030	cusD	Heavy metal efflux RND transmembrane protein
	Rmet_5031	cusC	Heavy metal efflux RND outer membrane protein, CzcC family
	Rmet_5032	cusB	Heavy metal efflux RND transporter, membrane fusion protein, CzcB family
	Rmet_5033	cusA	Heavy metal efflux RND transmembrane protein, CzcA family
	Rmet_5034	cusF	Heavy metal efflux RND periplasmic protein
Position: -349 Score: 5.8 Sequence: ACCTTCCCATGGCGGGAAGGA Locus tag: pMOL30_143 Name: copA2 Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: pMOL30_144 Name: copG Funciton: CopG protein
	pMOL30_143	copA2	Copper-translocating P-type ATPase (EC 3.6.3.4)
	pMOL30_144	copG	CopG protein
Position: -349 Score: 5.8 Sequence: ACCTTCCCATGGCGGGAAGGA Locus tag: Rmet_6119 Name: copA2 Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Rmet_6118 Name: copG Funciton: CopG protein
	Rmet_6119	copA2	Copper-translocating P-type ATPase (EC 3.6.3.4)
	Rmet_6118	copG	CopG protein
Position: -67 Score: 5.9 Sequence: ACCTTCCAATGGTGGTAAGGT Locus tag: Rmet_3524 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	Rmet_3524	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD