Regulon of ZntR in Stenotrophomonas maltophilia K279a

Properties
Regulator type:	Transcription factor
TF locus tag:	Smlt2949
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Zinc resistance
Effector:	Zinc ion, (Zn2+)
Regulog:	ZntR - Xanthomonadales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - ZntR
By TF family - MerR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc resistance

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 5 Sequence: ACTCTCGACCAGACTCCAGGCT Locus tag: Smlt2949 Name: zntR Funciton: Zinc resistance ranscriptional regulator, MerR family
	Smlt2949	zntR	Zinc resistance ranscriptional regulator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD