Regulon of ZntR in Stenotrophomonas maltophilia K279a
Regulator type: | Transcription factor |
TF locus tag: | Smlt2949 |
Regulator family: | MerR |
Regulation mode: | activator |
Biological process: | Zinc resistance |
Effector: | Zinc ion, (Zn2+) |
Regulog: | ZntR - Xanthomonadales |
Statistics of regulated genes: | |
- Genes | 1 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Xanthomonadales
- By trascription factor - ZntR
- By TF family - MerR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc resistance
Locus Tag | Name | Function | |
---|---|---|---|
Position: -57
Score: 5 Sequence: ACTCTCGACCAGACTCCAGGCT
Locus tag: Smlt2949
Name: zntR Funciton: Zinc resistance ranscriptional regulator, MerR family |
|||
zntR
|
Zinc resistance ranscriptional regulator, MerR family
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |