Regulog ZntR - Xanthomonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Zinc resistance |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By trascription factor - ZntR
- By TF family - MerR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc resistance
| Genome | Genes | Operons |
|---|---|---|
| Xylella fastidiosa 9a5c | ||
| Xanthomonas axonopodis pv. citri str. 306 | ||
| Xanthomonas campestris pv. campestris str. ATCC 33913 | ||
| Stenotrophomonas maltophilia K279a | 1 | 1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| zntR |
|
|
|
*
Stenotrophomonas maltophilia K279a Site: position = -57 score = 4.96134 sequence = ACTCTCGACCAGACTCCAGGCT Gene: Smlt2949: Zinc resistance ranscriptional regulator, MerR family |
Zinc resistance ranscriptional regulator, MerR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |