Regulon of SoxR in Alteromonadales bacterium TW-7

Properties
Regulator type:	Transcription factor
TF locus tag:	ATW7_01922
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Alteromonadales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 6.1 Sequence: ACCTCAATATAACTTGAGGT Locus tag: ATW7_01927 Name: PF03358 Funciton: NADPH-dependent FMN reductase
	ATW7_01927	PF03358	NADPH-dependent FMN reductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD