Regulon of RbtR in Rhodobacter sphaeroides 2.4.1

Properties
Regulator type:	Transcription factor
TF locus tag:	RSP_3700
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribitol utilization
Effector:	Ribitol
Regulog:	RbtR - Rhodobacterales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By effector - Ribitol
By pathway - Ribitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -95 Score: 5.7 Sequence: TGGCGCTATCGATTGCGCAA Position: -73 Score: 5.8 Sequence: ATGCTCAATCGATGTAGCAT Locus tag: RSP_3700 Name: rbtR Funciton: Ribitol utilization transcriptional regulator, LacI family
	RSP_3700	rbtR	Ribitol utilization transcriptional regulator, LacI family
Position: -167 Score: 5.8 Sequence: ATGCTACATCGATTGAGCAT Position: -145 Score: 5.7 Sequence: TTGCGCAATCGATAGCGCCA Locus tag: RSP_3701 Name: rbtA Funciton: Ribitol ABC transporter, periplasmic binding protein Locus tag: RSP_3702 Name: rbtB Funciton: Ribitol ABC transporter, ATP-binding component Locus tag: RSP_3703 Name: rbtC Funciton: Ribitol ABC transporter, permease protein Locus tag: RSP_3704 Name: rbtD Funciton: Ribitol 2-dehydrogenase (EC 1.1.1.56) Locus tag: RSP_3705 Name: rbtK Funciton: Putative D-ribulokinase (EC 2.7.1.47)
	RSP_3701	rbtA	Ribitol ABC transporter, periplasmic binding protein
	RSP_3702	rbtB	Ribitol ABC transporter, ATP-binding component
	RSP_3703	rbtC	Ribitol ABC transporter, permease protein
	RSP_3704	rbtD	Ribitol 2-dehydrogenase (EC 1.1.1.56)
	RSP_3705	rbtK	Putative D-ribulokinase (EC 2.7.1.47)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD