Regulog RbtR - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribitol utilization |
| Effector: | Ribitol |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By TF family - LacI
- By effector - Ribitol
- By pathway - Ribitol utilization
| Genome | Genes | Operons |
|---|---|---|
| Hyphomonas neptunium ATCC 15444 | ||
| Jannaschia sp. CCS1 | ||
| Loktanella vestfoldensis SKA53 | ||
| Oceanicaulis alexandrii HTCC2633 | ||
| Oceanicola batsensis HTCC2597 | ||
| Oceanicola granulosus HTCC2516 | ||
| Paracoccus denitrificans PD1222 | ||
| Rhodobacter sphaeroides 2.4.1 | 6 | 2 |
| Rhodobacterales bacterium HTCC2654 | ||
| Roseobacter sp. MED193 | ||
| Roseovarius nubinhibens ISM | ||
| Roseovarius sp. 217 | ||
| Silicibacter TM1040 | ||
| Silicibacter pomeroyi DSS-3 | ||
| Sulfitobacter sp. EE-36 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| rbtA |
|
|
|
|
|
|
|
*
Rhodobacter sphaeroides 2.4.1 Site: position = -167 score = 5.81606 sequence = ATGCTACATCGATTGAGCAT Site: position = -145 score = 5.65811 sequence = TTGCGCAATCGATAGCGCCA Gene: RSP_3701: Ribitol ABC transporter, periplasmic binding protein |
|
|
|
|
|
|
|
Ribitol ABC transporter, periplasmic binding protein |
| rbtB |
|
|
|
|
|
|
|
Gene: RSP_3702: Ribitol ABC transporter, ATP-binding component |
|
|
|
|
|
|
|
Ribitol ABC transporter, ATP-binding component |
| rbtC |
|
|
|
|
|
|
|
Gene: RSP_3703: Ribitol ABC transporter, permease protein |
|
|
|
|
|
|
|
Ribitol ABC transporter, permease protein |
| rbtD |
|
|
|
|
|
|
Gene: Pden_2157: Ribitol 2-dehydrogenase (EC 1.1.1.56) |
Gene: RSP_3704: Ribitol 2-dehydrogenase (EC 1.1.1.56) |
|
|
|
|
|
|
|
Ribitol 2-dehydrogenase (EC 1.1.1.56) |
| rbtK |
|
|
|
|
|
|
Gene: Pden_2156: Putative D-ribulokinase (EC 2.7.1.47) |
Gene: RSP_3705: Putative D-ribulokinase (EC 2.7.1.47) |
|
|
|
|
|
|
|
Putative D-ribulokinase (EC 2.7.1.47) |
| CRON 2. | ||||||||||||||||
| rbtR |
|
|
|
|
|
|
|
*
Rhodobacter sphaeroides 2.4.1 Site: position = -95 score = 5.65811 sequence = TGGCGCTATCGATTGCGCAA Site: position = -73 score = 5.81606 sequence = ATGCTCAATCGATGTAGCAT Gene: RSP_3700: Ribitol utilization transcriptional regulator, LacI family |
|
|
|
|
|
|
|
Ribitol utilization transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |