Regulon of OB2597_06045 in Oceanicola batsensis HTCC2597

Properties
Regulator type:	Transcription factor
TF locus tag:	OB2597_06045
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	OB2597_06045 - Rhodobacterales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -88 Score: 6 Sequence: TTCTGGGAACGTTCCCGCAA Locus tag: OB2597_06050 Name: PF00701 Funciton: Dihydropicolinate synthase-like protein
	OB2597_06050	PF00701	Dihydropicolinate synthase-like protein
Position: -186 Score: 6 Sequence: TTGCGGGAACGTTCCCAGAA Locus tag: OB2597_06045 Name: OB2597_06045 Funciton: Putative regulator, LacI family
	OB2597_06045	OB2597_06045	Putative regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD