Regulog OB2597_06045 - Rhodobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633
Jannaschia sp. CCS1
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597	2	2
Oceanicola granulosus HTCC2516
Paracoccus denitrificans PD1222
Rhodobacter sphaeroides 2.4.1
Rhodobacterales bacterium HTCC2654
Roseobacter sp. MED193
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Sulfitobacter sp. EE-36

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
PF00701	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	* Oceanicola batsensis HTCC2597 Site: position = -88 score = 6.0497 sequence = TTCTGGGAACGTTCCCGCAA Gene: OB2597_06050: Dihydropicolinate synthase-like protein	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Dihydropicolinate synthase-like protein

CRON 2.
OB2597_06045	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	* Oceanicola batsensis HTCC2597 Site: position = -186 score = 6.0497 sequence = TTGCGGGAACGTTCCCAGAA Gene: OB2597_06045: Putative regulator, LacI family	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Putative regulator, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --