Regulon of RL3595 in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL3595
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	RL3595 - Rhizobiales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 6.7 Sequence: TAGTGGGAACGTTCCCGTAA Locus tag: RL3594 Name: PF00701 Funciton: Dihydrodipicolinate synthase-like protein Locus tag: RL3593 Name: PF00083 Funciton: Putative sugar phosphate permease, MFS superfamily
	RL3594	PF00701	Dihydrodipicolinate synthase-like protein
	RL3593	PF00083	Putative sugar phosphate permease, MFS superfamily
Position: -107 Score: 6.7 Sequence: TTACGGGAACGTTCCCACTA Locus tag: RL3595 Name: RL3595 Funciton: Putative regulator of PF00701, LacI family
	RL3595	RL3595	Putative regulator of PF00701, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD