Regulog RL3595 - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 3 | 2 |
| Azorhizobium caulinodans ORS 571 | 3 | 2 |
| Rhizobium leguminosarum bv. viciae 3841 | 3 | 2 |
| Rhizobium sp. NGR234 | ||
| Rhizobium etli CFN 42 | 3 | 2 |
| Sinorhizobium meliloti 1021 | ||
| Xanthobacter autotrophicus Py2 | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Rhodopseudomonas palustris CGA009 | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Bartonella quintana str. Toulouse | ||
| Brucella melitensis 16M |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| PF00701 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -82 score = 7.04236 sequence = TAACGGGAACGTTCCCATTA Gene: Atu5394: Dihydrodipicolinate synthase-like protein |
*
Azorhizobium caulinodans ORS 571 Site: position = -93 score = 6.65526 sequence = TGATGGGAACGTTCCCGCTA Gene: AZC_2857: Dihydrodipicolinate synthase-like protein |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -74 score = 6.73823 sequence = TAGTGGGAACGTTCCCGTAA Gene: RL3594: Dihydrodipicolinate synthase-like protein |
|
*
Rhizobium etli CFN 42 Site: position = -73 score = 6.90024 sequence = TAGTGGGAACGTTCCCAATA Gene: RHE_CH03149: Dihydrodipicolinate synthase-like protein |
|
|
|
|
|
|
Gene: BBta_1167: Dihydrodipicolinate synthase-like protein |
|
|
|
Dihydrodipicolinate synthase-like protein |
| PF00083 |
Gene: Atu5395: Putative sugar phosphate permease, MFS superfamily |
Gene: AZC_2858: Putative sugar phosphate permease, MFS superfamily |
Gene: RL3593: Putative sugar phosphate permease, MFS superfamily |
|
Gene: RHE_CH03148: Putative sugar phosphate permease, MFS superfamily |
|
|
|
|
|
|
|
|
|
|
Putative sugar phosphate permease, MFS superfamily |
| CRON 2. | ||||||||||||||||
| RL3595 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -109 score = 7.04236 sequence = TAATGGGAACGTTCCCGTTA Gene: Atu5393: Putative regulator of PF00701, LacI family |
*
Azorhizobium caulinodans ORS 571 Site: position = -28 score = 6.65526 sequence = TAGCGGGAACGTTCCCATCA Gene: AZC_2856: Putative regulator of PF00701, LacI family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -107 score = 6.73823 sequence = TTACGGGAACGTTCCCACTA Gene: RL3595: Putative regulator of PF00701, LacI family |
|
*
Rhizobium etli CFN 42 Site: position = -108 score = 6.90024 sequence = TATTGGGAACGTTCCCACTA Gene: RHE_CH03150: Putative regulator of PF00701, LacI family |
|
|
|
|
|
|
|
|
|
|
Putative regulator of PF00701, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |