Regulon of AglR in Silicibacter TM1040

Properties
Regulator type:	Transcription factor
TF locus tag:	TM1040_3308
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Alpha-glucosides utilization
Effector:	Alpha-glucoside; Maltose; Sucrose; Trehalose
Regulog:	AglR - Rhodobacterales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By effector - Alpha-glucoside
By effector - Maltose
By effector - Sucrose
By effector - Trehalose
By pathway - Alpha-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -257 Score: 5.1 Sequence: CCTCCAAAGCGCTTTAAAAA Position: -102 Score: 6.3 Sequence: CAATCAAAGCGCTTTGAATC Locus tag: TM1040_3307 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: TM1040_3306 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: TM1040_3305 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: TM1040_3304 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: TM1040_3303 Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein
	TM1040_3307	aglE	Alpha-glucoside ABC transporter periplasmic sugar-binding protein
	TM1040_3306	aglF	Alpha-glucoside ABC transporter permease protein
	TM1040_3305	aglG	Alpha-glucoside ABC transporter permease protein
	TM1040_3304	aglA	Alpha-glucosidase AglA
	TM1040_3303	aglK	Alpha-glucoside ABC transporter ATP-binding protein
Position: -184 Score: 6.3 Sequence: GATTCAAAGCGCTTTGATTG Position: -29 Score: 5.1 Sequence: TTTTTAAAGCGCTTTGGAGG Locus tag: TM1040_3308 Name: aglR Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family Locus tag: TM1040_3309 Name: RSP_2874 Funciton: Beta-glucosidase (EC 3.2.1.21)
	TM1040_3308	aglR	Transcriptional regulator of alpha-glucoside utilization, LacI family
	TM1040_3309	RSP_2874	Beta-glucosidase (EC 3.2.1.21)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD