Regulon of AglR in Loktanella vestfoldensis SKA53

Properties
Regulator type:	Transcription factor
TF locus tag:	SKA53_03274
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Alpha-glucosides utilization
Effector:	Alpha-glucoside; Maltose; Sucrose; Trehalose
Regulog:	AglR - Rhodobacterales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By effector - Alpha-glucoside
By effector - Maltose
By effector - Sucrose
By effector - Trehalose
By pathway - Alpha-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 6.2 Sequence: GTACCAAAGCGCTTTGGATG Locus tag: SKA53_03274 Name: aglR Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family Locus tag: SKA53_03269 Name: RSP_2874 Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: SKA53_03264 Name: glk Funciton: Glucokinase (EC 2.7.1.2)
	SKA53_03274	aglR	Transcriptional regulator of alpha-glucoside utilization, LacI family
	SKA53_03269	RSP_2874	Beta-glucosidase (EC 3.2.1.21)
	SKA53_03264	glk	Glucokinase (EC 2.7.1.2)
Position: -112 Score: 6.2 Sequence: CATCCAAAGCGCTTTGGTAC Locus tag: SKA53_03279 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: SKA53_03284 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: SKA53_03289 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: SKA53_03294 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: SKA53_03299 Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein
	SKA53_03279	aglE	Alpha-glucoside ABC transporter periplasmic sugar-binding protein
	SKA53_03284	aglF	Alpha-glucoside ABC transporter permease protein
	SKA53_03289	aglG	Alpha-glucoside ABC transporter permease protein
	SKA53_03294	aglA	Alpha-glucosidase AglA
	SKA53_03299	aglK	Alpha-glucoside ABC transporter ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD