Regulon of AglR in Oceanicola granulosus HTCC2516

Properties
Regulator type:	Transcription factor
TF locus tag:	OG2516_02414
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Alpha-glucosides utilization
Effector:	Alpha-glucoside; Maltose; Sucrose; Trehalose
Regulog:	AglR - Rhodobacterales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By effector - Alpha-glucoside
By effector - Maltose
By effector - Sucrose
By effector - Trehalose
By pathway - Alpha-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -194 Score: 6.1 Sequence: GGATCAAAGCGCTTTGGACG Position: -28 Score: 5.1 Sequence: CTCCTAAAGCGCTTTGGAAG Locus tag: OG2516_02414 Name: aglR Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family Locus tag: OG2516_02409 Name: glk Funciton: Glucokinase (EC 2.7.1.2)
	OG2516_02414	aglR	Transcriptional regulator of alpha-glucoside utilization, LacI family
	OG2516_02409	glk	Glucokinase (EC 2.7.1.2)
Position: -96 Score: 6.1 Sequence: CGTCCAAAGCGCTTTGATCC Locus tag: OG2516_02419 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: OG2516_02424 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: OG2516_02429 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: OG2516_02434 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: OG2516_02439 Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein
	OG2516_02419	aglE	Alpha-glucoside ABC transporter periplasmic sugar-binding protein
	OG2516_02424	aglF	Alpha-glucoside ABC transporter permease protein
	OG2516_02429	aglG	Alpha-glucoside ABC transporter permease protein
	OG2516_02434	aglA	Alpha-glucosidase AglA
	OG2516_02439	aglK	Alpha-glucoside ABC transporter ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD