Regulon of AglR in Jannaschia sp. CCS1

Properties
Regulator type:	Transcription factor
TF locus tag:	Jann_1945
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Alpha-glucosides utilization
Effector:	Alpha-glucoside; Maltose; Sucrose; Trehalose
Regulog:	AglR - Rhodobacterales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By effector - Alpha-glucoside
By effector - Maltose
By effector - Sucrose
By effector - Trehalose
By pathway - Alpha-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -104 Score: 4.9 Sequence: ACCCCAAAGCGCTTTGAAAA Locus tag: Jann_1946 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: Jann_1947 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: Jann_1948 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: Jann_1949 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: Jann_1950 Name: aglK Funciton: Alpha-glucoside ABC transporter ATP-binding protein
	Jann_1946	aglE	Alpha-glucoside ABC transporter periplasmic sugar-binding protein
	Jann_1947	aglF	Alpha-glucoside ABC transporter permease protein
	Jann_1948	aglG	Alpha-glucoside ABC transporter permease protein
	Jann_1949	aglA	Alpha-glucosidase AglA
	Jann_1950	aglK	Alpha-glucoside ABC transporter ATP-binding protein
Position: -204 Score: 4.9 Sequence: TTTTCAAAGCGCTTTGGGGT Position: -31 Score: 5.8 Sequence: AATTCCAAGCGCTTTGAAAG Locus tag: Jann_1945 Name: aglR Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family Locus tag: Jann_1944 Name: RSP_2874 Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: Jann_1943 Name: glk Funciton: Glucokinase (EC 2.7.1.2)
	Jann_1945	aglR	Transcriptional regulator of alpha-glucoside utilization, LacI family
	Jann_1944	RSP_2874	Beta-glucosidase (EC 3.2.1.21)
	Jann_1943	glk	Glucokinase (EC 2.7.1.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD