Regulon of NiaR in Clostridium kluyveri DSM 555

Properties
Regulator type:	Transcription factor
TF locus tag:	CKL_0014
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Clostridia-1
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -36 Score: 6.5 Sequence: TACTGGTGTATATACATTTGTT Locus tag: CKL_1488 Name: niaX Funciton: Substrate-specific component NiaX of predicted niacin ECF transporter
	CKL_1488	niaX	Substrate-specific component NiaX of predicted niacin ECF transporter
Position: -110 Score: 6.4 Sequence: TACTGATGTATATACAGTAGAA Locus tag: CKL_0748 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: CKL_0749 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: CKL_0750 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	CKL_0748	nadA	Quinolinate synthetase (EC 4.1.99.-)
	CKL_0749	nadB	L-aspartate oxidase (EC 1.4.3.16)
	CKL_0750	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD