Regulon of NiaR in Clostridium butyricum 5521

Properties
Regulator type:	Transcription factor
TF locus tag:	CBY_1477
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Clostridia-1
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -144 Score: 6.8 Sequence: TACTAATGTATATACACTAGTA Locus tag: CBY_0041 Name: niaX Funciton: Substrate-specific component NiaX of predicted niacin ECF transporter
	CBY_0041	niaX	Substrate-specific component NiaX of predicted niacin ECF transporter
Position: -46 Score: 6.3 Sequence: AAAAGGTGTATATACACCTGTA Locus tag: CBY_3922 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: CBY_3921 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: CBY_3920 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	CBY_3922	nadA	Quinolinate synthetase (EC 4.1.99.-)
	CBY_3921	nadB	L-aspartate oxidase (EC 1.4.3.16)
	CBY_3920	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD