Regulon of NiaR in Clostridium difficile 630

Properties
Regulator type:	Transcription factor
TF locus tag:	CD0012
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Clostridia-2
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-2
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -92 Score: 4.4 Sequence: TTTTAGTGAAATAACATTTGTC Position: -80 Score: 4.6 Sequence: AACATTTGTCTTGTCAGCTGAA Locus tag: CD2256 Name: niaY Funciton: Predicted nicotinate-regulated transporter NiaY
	CD2256	niaY	Predicted nicotinate-regulated transporter NiaY
Position: -43 Score: 6 Sequence: TACAGGTGTATATACACTAGTA Locus tag: CD2372 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: CD2371 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: CD2370 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	CD2372	nadA	Quinolinate synthetase (EC 4.1.99.-)
	CD2371	nadB	L-aspartate oxidase (EC 1.4.3.16)
	CD2370	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD