Regulog NiaR - Clostridia-2

Member of regulog collections
- By taxonomy - Clostridia-2
- By TF family - NiaR
- By effector - Niacin
- By pathway - NAD biosynthesis
Genome | Genes | Operons |
---|---|---|
Clostridium bartlettii DSM 16795 | 5 | 3 |
Clostridium difficile 630 | 4 | 2 |
Clostridium hiranonis DSM 13275 |
Genes | Function | |||
---|---|---|---|---|
CRON 1. | ||||
niaR |
*
Clostridium bartlettii DSM 16795 Site: position = -204 score = 6.38176 sequence = TACACGTGTATTTACACTTGTA Site: position = -216 score = 5.52907 sequence = TTTAAAAGTATTTACACGTGTA Gene: CLOBAR_00530: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: CD0012: NAD biosynthesis transcription regulator, HTH_11 family |
|
NAD biosynthesis transcription regulator, HTH_11 family |
CRON 2. | ||||
niaY |
*
Clostridium bartlettii DSM 16795 Site: position = -77 score = 5.54825 sequence = TTTACATGTAATTTCATTTGTA Site: position = -89 score = 5.31805 sequence = TTTAAATGTAAATTTACATGTA Gene: CLOBAR_02625: Predicted nicotinate-regulated transporter NiaY |
*
Clostridium difficile 630 Site: position = -80 score = 4.57444 sequence = AACATTTGTCTTGTCAGCTGAA Site: position = -92 score = 4.41714 sequence = TTTTAGTGAAATAACATTTGTC Gene: CD2256: Predicted nicotinate-regulated transporter NiaY |
|
Predicted nicotinate-regulated transporter NiaY |
CRON 3. | ||||
nadA |
*
Clostridium bartlettii DSM 16795 Site: position = -49 score = 6.38176 sequence = TACAAGTGTAAATACACGTGTA Site: position = -37 score = 5.52907 sequence = TACACGTGTAAATACTTTTAAA Gene: CLOBAR_00531: Quinolinate synthetase (EC 4.1.99.-) |
*
Clostridium difficile 630 Site: position = -43 score = 6.03774 sequence = TACAGGTGTATATACACTAGTA Gene: CD2372: Quinolinate synthetase (EC 4.1.99.-) |
Gene: CLOHIR_00157: Quinolinate synthetase (EC 4.1.99.-) |
Quinolinate synthetase (EC 4.1.99.-) |
nadB |
Gene: CLOBAR_00532: L-aspartate oxidase (EC 1.4.3.16) |
Gene: CD2371: L-aspartate oxidase (EC 1.4.3.16) |
Gene: CLOHIR_00158: L-aspartate oxidase (EC 1.4.3.16) |
L-aspartate oxidase (EC 1.4.3.16) |
nadC |
Gene: CLOBAR_00533: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: CD2370: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Gene: CLOHIR_00159: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |